Mutagenetix > Incidental Mutation

Incidental Mutation 'R0403:Kif13a'

35731

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

038608-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.358) question?

Stock #

R0403 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

46749087-46929867 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46791401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 908 (V908A)

Ref Sequence

ENSEMBL: ENSMUSP00000055304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881] [ENSMUST00000225591]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000056978
AA Change: V908A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: V908A

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223856

Predicted Effect

probably benign
Transcript: ENSMUST00000223881

Predicted Effect

probably benign
Transcript: ENSMUST00000224756
AA Change: V16A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225591
AA Change: V845A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225904

Meta Mutation Damage Score

0.2033

Coding Region Coverage

1x: 98.0%
3x: 96.8%
10x: 93.2%
20x: 83.7%

Validation Efficiency

97% (110/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	A	G	11: 105,973,880		probably null	Het
Adgrg3	C	T	8: 95,036,922	L284F	probably benign	Het
Alkbh8	T	A	9: 3,385,469	V587E	probably damaging	Het
Ap4b1	T	A	3: 103,818,839	C244S	probably damaging	Het
Ap4b1	T	A	3: 103,821,396	M590K	probably benign	Het
Arhgap15	C	T	2: 44,063,766	T168I	probably damaging	Het
Arntl2	T	A	6: 146,822,655	H348Q	probably damaging	Het
Atp8b1	A	G	18: 64,540,310	V997A	probably damaging	Het
Atrn	G	A	2: 130,906,859	C100Y	probably damaging	Het
Baiap2l2	C	A	15: 79,271,216	A151S	probably benign	Het
Baz2b	A	T	2: 59,969,377	D199E	possibly damaging	Het
Cblb	A	G	16: 52,152,626	D440G	probably benign	Het
Cdon	T	C	9: 35,473,500	V694A	probably benign	Het
Cep250	A	T	2: 155,992,349	R2065W	probably damaging	Het
Ces2b	G	T	8: 104,833,945	A131S	probably damaging	Het
Chrna9	A	T	5: 65,967,892	T59S	possibly damaging	Het
Cog3	T	A	14: 75,742,327		probably benign	Het
Cpa1	G	A	6: 30,641,857	V227I	probably benign	Het
Cyp3a25	A	T	5: 145,998,513	C98S	probably damaging	Het
D8Ertd738e	C	T	8: 84,249,601		probably null	Het
Ddx60	A	G	8: 61,994,541		probably benign	Het
Dhx16	T	C	17: 35,883,050		probably null	Het
Dnah9	T	A	11: 66,084,789	Q1478L	possibly damaging	Het
Dock10	T	C	1: 80,524,070	Y1434C	possibly damaging	Het
Enpp3	T	A	10: 24,804,436	D325V	probably damaging	Het
Entpd6	C	A	2: 150,760,170	T194K	possibly damaging	Het
Fam208b	A	T	13: 3,582,052	Y816*	probably null	Het
Fat2	A	T	11: 55,270,349	V3185E	probably benign	Het
Flrt1	A	G	19: 7,095,919	L421P	probably benign	Het
Fmn2	A	T	1: 174,694,278	Q1292L	probably damaging	Het
Fndc1	T	C	17: 7,775,588		probably null	Het
Fndc1	T	C	17: 7,753,723	D1459G	probably damaging	Het
Fzr1	A	G	10: 81,369,368	S265P	possibly damaging	Het
Gm13119	A	G	4: 144,362,646	N178S	probably benign	Het
Gm14085	T	C	2: 122,521,854	L364S	probably damaging	Het
Gpr142	G	A	11: 114,806,029	V134M	probably damaging	Het
Grid2ip	G	T	5: 143,357,620	V24L	possibly damaging	Het
Herc2	G	A	7: 56,159,417	R2555H	probably damaging	Het
Hpdl	A	T	4: 116,820,479	Y262N	possibly damaging	Het
Htr3a	A	G	9: 48,908,659	V57A	probably damaging	Het
Igfbp7	T	C	5: 77,355,591	I186V	probably benign	Het
Itga2b	C	T	11: 102,467,326		probably null	Het
Itgae	A	C	11: 73,123,183	D736A	possibly damaging	Het
Itpkc	T	A	7: 27,208,345	M645L	probably benign	Het
Jchain	T	C	5: 88,521,378	R139G	probably benign	Het
Kif1b	T	A	4: 149,181,967	K389*	probably null	Het
Klhl12	T	C	1: 134,485,856	Y360H	possibly damaging	Het
Knop1	G	A	7: 118,853,053	R148W	probably damaging	Het
Lpar1	T	A	4: 58,487,191	N27Y	probably damaging	Het
Lpar2	T	A	8: 69,824,152	V197D	probably damaging	Het
Lrrc74a	A	G	12: 86,740,979	N128S	probably damaging	Het
Lum	G	T	10: 97,572,043	V337F	probably benign	Het
Mag	T	C	7: 30,906,980	D344G	probably damaging	Het
Maip1	G	A	1: 57,407,196	A142T	probably benign	Het
Mlh3	A	G	12: 85,268,968	V148A	possibly damaging	Het
Nav3	A	G	10: 109,767,103	V1195A	probably damaging	Het
Ncor2	A	G	5: 125,033,337	S868P	possibly damaging	Het
Nek1	A	G	8: 61,106,855	E907G	probably damaging	Het
Nfam1	G	A	15: 83,016,379	T134I	probably benign	Het
Nr0b2	T	C	4: 133,553,759	V112A	probably damaging	Het
Nrp1	A	G	8: 128,457,969	N365S	probably damaging	Het
Nrsn2	T	C	2: 152,369,790	Y107C	probably damaging	Het
Ntng1	G	A	3: 109,934,611	A282V	probably damaging	Het
Nxf1	T	C	19: 8,765,028	I337T	probably damaging	Het
Obscn	C	T	11: 59,076,540	G479D	probably damaging	Het
Olfr45	T	C	7: 140,691,309	S135P	possibly damaging	Het
Oprd1	T	A	4: 132,113,768	D293V	probably benign	Het
P3h2	T	G	16: 25,969,950	N586H	possibly damaging	Het
Pcid2	T	C	8: 13,085,367	Y214C	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Ppic	C	A	18: 53,411,071	G81W	probably damaging	Het
Ppp2r1a	C	A	17: 20,957,041	P246T	probably damaging	Het
Ppp4r4	T	G	12: 103,584,102	S46A	probably benign	Het
Prkce	A	G	17: 86,168,653	T21A	probably damaging	Het
Prkg2	T	C	5: 98,994,645	E210G	possibly damaging	Het
Prss35	A	G	9: 86,756,037	M287V	probably damaging	Het
Psd	G	A	19: 46,320,972		probably benign	Het
Ptch2	A	T	4: 117,110,839	K843*	probably null	Het
Rab44	C	A	17: 29,145,261	T603K	probably damaging	Het
Rasal3	T	A	17: 32,392,790		probably null	Het
Rbbp6	A	G	7: 122,992,296	T526A	probably damaging	Het
Ros1	A	T	10: 52,143,438		probably benign	Het
Sec24b	T	A	3: 129,989,676	L1104F	possibly damaging	Het
Sec24b	A	G	3: 129,999,534	S685P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Setmar	A	T	6: 108,075,962	H139L	probably benign	Het
Slc4a7	T	C	14: 14,766,808	V710A	probably benign	Het
Smarcc1	T	A	9: 110,237,808		probably null	Het
Smchd1	G	A	17: 71,394,902	L1032F	probably damaging	Het
Speg	T	C	1: 75,430,784		probably benign	Het
Tcea1	C	G	1: 4,889,503	R134G	probably benign	Het
Tchhl1	C	T	3: 93,471,029	Q347*	probably null	Het
Tecrl	A	T	5: 83,354,758		probably benign	Het
Tepsin	T	C	11: 120,093,682		probably benign	Het
Tmem40	G	A	6: 115,733,985		probably benign	Het
Tpr	G	A	1: 150,407,414		probably benign	Het
Ttll12	A	T	15: 83,580,658		probably benign	Het
Ttn	T	A	2: 76,909,608	D3529V	probably benign	Het
Usp34	T	A	11: 23,333,838	H177Q	possibly damaging	Het
Vsig10	T	A	5: 117,338,461	S327T	probably benign	Het
Zbtb4	T	A	11: 69,777,639	M396K	probably damaging	Het
Zfp352	C	T	4: 90,225,009	T462I	possibly damaging	Het
Zfp385b	T	C	2: 77,476,845	M145V	probably damaging	Het
Zfp780b	C	A	7: 27,971,689	V65F	possibly damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46750634	splice site	probably benign
IGL01433:Kif13a	APN	13	46772908	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	46864837	splice site	probably benign
IGL01536:Kif13a	APN	13	46752289	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	46864820	missense	probably benign
IGL02020:Kif13a	APN	13	46794019	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46771535	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46825222	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46785293	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46785296	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46772838	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46752088	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46764623	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46786511	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0135:Kif13a	UTSW	13	46793943	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46764603	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46791351	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46814219	missense	possibly damaging	0.95
R0492:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46802711	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46778888	unclassified	probably benign
R0654:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	46848337	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46799213	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46812823	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46814236	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	46929259	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46825235	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46791511	splice site	probably benign
R1449:Kif13a	UTSW	13	46812736	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	46929612	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46809213	missense	probably benign
R1579:Kif13a	UTSW	13	46752856	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46793922	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46793922	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46798409	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46752613	missense	possibly damaging	0.73
R1755:Kif13a	UTSW	13	46773678	missense	possibly damaging	0.50
R1858:Kif13a	UTSW	13	46864838	splice site	probably benign
R1891:Kif13a	UTSW	13	46929219	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46788162	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46812745	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	46864838	splice site	probably benign
R1961:Kif13a	UTSW	13	46864838	splice site	probably benign
R2016:Kif13a	UTSW	13	46810799	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46752469	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46769176	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46777097	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46814200	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46764596	splice site	probably benign
R3499:Kif13a	UTSW	13	46825339	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46802690	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46814155	splice site	probably null
R4771:Kif13a	UTSW	13	46825211	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46826748	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	46929599	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46809055	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46777163	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46788085	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46802646	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46752721	missense	probably benign
R5329:Kif13a	UTSW	13	46775401	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46772769	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46832736	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46752115	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46752862	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46825300	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46771524	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46801313	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46826757	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46815207	splice site	probably null
R6393:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46809156	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46826745	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46750613	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46798479	missense	probably benign
R8098:Kif13a	UTSW	13	46815304	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46778968	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46752581	missense	probably benign	0.01
R8806:Kif13a	UTSW	13	46761337	missense	possibly damaging	0.49
R8871:Kif13a	UTSW	13	46830803	missense	probably damaging	1.00
R8877:Kif13a	UTSW	13	46801445	critical splice acceptor site	probably null
R8906:Kif13a	UTSW	13	46773678	missense	probably benign	0.17
R9028:Kif13a	UTSW	13	46798365	missense	probably damaging	1.00
R9058:Kif13a	UTSW	13	46791465	missense	probably damaging	1.00
R9062:Kif13a	UTSW	13	46788060	missense	possibly damaging	0.91
R9070:Kif13a	UTSW	13	46752458	missense	probably benign	0.00
R9083:Kif13a	UTSW	13	46812787	missense	probably damaging	1.00
R9250:Kif13a	UTSW	13	46775433	missense	probably damaging	1.00
R9328:Kif13a	UTSW	13	46798362	missense	probably damaging	1.00
R9360:Kif13a	UTSW	13	46808996	missense	probably benign	0.01
R9369:Kif13a	UTSW	13	46786623	missense	probably damaging	0.99
R9589:Kif13a	UTSW	13	46802544	missense	probably benign	0.01
X0013:Kif13a	UTSW	13	46929270	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- AAGACCGTGCCCAATTCCACTG -3'
(R):5'- GGCTGTCCTGGTATTGATCCCCTG -3'

Sequencing Primer
(F):5'- AGCTGACAGTGGCTCTGTG -3'
(R):5'- CCCCTCTTAGAGATGACTGAACTATG -3'

Posted On

2013-05-09