Mutagenetix > Incidental Mutation

Incidental Mutation 'R4748:Bptf'

357321

Institutional Source

Beutler Lab

Gene Symbol

Bptf

Ensembl Gene

ENSMUSG00000040481

Gene Name

bromodomain PHD finger transcription factor

Synonyms

9430093H17Rik, Falz

MMRRC Submission

042030-MU

Accession Numbers

Genbank: NM_176850; MGI: 2444008

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107033081-107132127 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107095880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 581 (D581G)

Ref Sequence

ENSEMBL: ENSMUSP00000102374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000057892
AA Change: D581G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: D581G

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
coiled coil region	864	894	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1062	1072	N/A	INTRINSIC
low complexity region	1086	1098	N/A	INTRINSIC
low complexity region	1225	1238	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1491	1503	N/A	INTRINSIC
low complexity region	1594	1613	N/A	INTRINSIC
low complexity region	1636	1645	N/A	INTRINSIC
low complexity region	1665	1683	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
coiled coil region	1908	1936	N/A	INTRINSIC
low complexity region	1941	1957	N/A	INTRINSIC
low complexity region	2051	2061	N/A	INTRINSIC
low complexity region	2092	2107	N/A	INTRINSIC
low complexity region	2115	2128	N/A	INTRINSIC
low complexity region	2175	2197	N/A	INTRINSIC
low complexity region	2227	2252	N/A	INTRINSIC
low complexity region	2275	2312	N/A	INTRINSIC
low complexity region	2336	2355	N/A	INTRINSIC
low complexity region	2361	2378	N/A	INTRINSIC
low complexity region	2390	2420	N/A	INTRINSIC
low complexity region	2430	2463	N/A	INTRINSIC
coiled coil region	2489	2527	N/A	INTRINSIC
coiled coil region	2576	2604	N/A	INTRINSIC
low complexity region	2663	2700	N/A	INTRINSIC
low complexity region	2713	2736	N/A	INTRINSIC
PHD	2744	2791	5.32e-9	SMART
BROMO	2800	2908	5.5e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106762
AA Change: D581G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: D581G

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
internal_repeat_1	589	642	6.48e-5	PROSPERO
low complexity region	644	654	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC
coiled coil region	926	956	N/A	INTRINSIC
low complexity region	1013	1025	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1114	1124	N/A	INTRINSIC
low complexity region	1138	1150	N/A	INTRINSIC
low complexity region	1277	1290	N/A	INTRINSIC
low complexity region	1303	1317	N/A	INTRINSIC
internal_repeat_1	1387	1440	6.48e-5	PROSPERO
low complexity region	1543	1555	N/A	INTRINSIC
low complexity region	1646	1665	N/A	INTRINSIC
low complexity region	1688	1697	N/A	INTRINSIC
low complexity region	1717	1735	N/A	INTRINSIC
low complexity region	1870	1886	N/A	INTRINSIC
coiled coil region	1960	1988	N/A	INTRINSIC
low complexity region	1993	2009	N/A	INTRINSIC
low complexity region	2103	2113	N/A	INTRINSIC
low complexity region	2144	2159	N/A	INTRINSIC
low complexity region	2167	2180	N/A	INTRINSIC
low complexity region	2227	2249	N/A	INTRINSIC
low complexity region	2279	2304	N/A	INTRINSIC
low complexity region	2327	2364	N/A	INTRINSIC
low complexity region	2388	2407	N/A	INTRINSIC
low complexity region	2413	2430	N/A	INTRINSIC
low complexity region	2442	2472	N/A	INTRINSIC
low complexity region	2482	2515	N/A	INTRINSIC
coiled coil region	2541	2579	N/A	INTRINSIC
coiled coil region	2628	2656	N/A	INTRINSIC
low complexity region	2715	2752	N/A	INTRINSIC
low complexity region	2765	2788	N/A	INTRINSIC
PHD	2796	2843	5.32e-9	SMART
BROMO	2852	2960	5.5e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106763
AA Change: D581G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: D581G

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.9e-8	PFAM
PHD	404	447	2.23e-11	SMART
low complexity region	624	639	N/A	INTRINSIC
low complexity region	707	717	N/A	INTRINSIC
low complexity region	725	742	N/A	INTRINSIC
coiled coil region	989	1019	N/A	INTRINSIC
low complexity region	1076	1088	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
low complexity region	1201	1213	N/A	INTRINSIC
low complexity region	1340	1353	N/A	INTRINSIC
low complexity region	1366	1380	N/A	INTRINSIC
low complexity region	1606	1618	N/A	INTRINSIC
low complexity region	1709	1728	N/A	INTRINSIC
low complexity region	1751	1760	N/A	INTRINSIC
low complexity region	1780	1798	N/A	INTRINSIC
low complexity region	1933	1949	N/A	INTRINSIC
coiled coil region	2023	2051	N/A	INTRINSIC
low complexity region	2056	2072	N/A	INTRINSIC
low complexity region	2166	2176	N/A	INTRINSIC
low complexity region	2207	2222	N/A	INTRINSIC
low complexity region	2230	2243	N/A	INTRINSIC
low complexity region	2290	2312	N/A	INTRINSIC
low complexity region	2342	2367	N/A	INTRINSIC
low complexity region	2390	2427	N/A	INTRINSIC
low complexity region	2451	2470	N/A	INTRINSIC
low complexity region	2476	2493	N/A	INTRINSIC
low complexity region	2505	2535	N/A	INTRINSIC
low complexity region	2545	2578	N/A	INTRINSIC
coiled coil region	2604	2642	N/A	INTRINSIC
coiled coil region	2691	2719	N/A	INTRINSIC
low complexity region	2778	2815	N/A	INTRINSIC
low complexity region	2828	2851	N/A	INTRINSIC
PHD	2859	2906	5.32e-9	SMART
BROMO	2915	3023	5.5e-37	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]

Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310009B15Rik	T	A	1: 138,856,656	E54D	possibly damaging	Het
4933415F23Rik	T	C	1: 23,101,870	E121G	probably damaging	Het
Abcb6	C	A	1: 75,177,358	G367W	probably damaging	Het
Asprv1	A	G	6: 86,628,423	M84V	probably damaging	Het
Aspscr1	T	C	11: 120,701,507	V291A	probably damaging	Het
B4galnt4	T	C	7: 141,071,720	F980L	probably damaging	Het
Bpi	G	A	2: 158,272,021	V280I	possibly damaging	Het
Cap2	T	A	13: 46,639,826	Y223N	possibly damaging	Het
Ccdc141	A	C	2: 77,057,980	I480M	possibly damaging	Het
Ccnh	T	A	13: 85,189,639	V35E	probably benign	Het
Cd6	G	T	19: 10,794,225	S433*	probably null	Het
Ceacam10	A	C	7: 24,781,052	I83L	probably benign	Het
Chek2	T	C	5: 110,855,839		probably null	Het
Chia1	A	T	3: 106,122,449	D73V	probably damaging	Het
Commd2	G	A	3: 57,646,794	T162I	probably benign	Het
Creb3l3	C	T	10: 81,086,047	A316T	probably benign	Het
Cul4a	A	G	8: 13,123,526	K1R	probably benign	Het
Cyp2c23	T	C	19: 44,016,737		probably null	Het
D630045J12Rik	T	C	6: 38,196,841	T131A	possibly damaging	Het
Dctn4	A	C	18: 60,550,236	K295N	probably damaging	Het
Dnah1	A	G	14: 31,319,945	V23A	probably benign	Het
Dync1i1	A	G	6: 5,767,048	K91E	possibly damaging	Het
Dzip1l	A	G	9: 99,642,651	D275G	probably damaging	Het
Enam	C	A	5: 88,501,543	P304T	probably damaging	Het
Enpep	A	G	3: 129,332,163	Y107H	probably damaging	Het
Exd2	T	C	12: 80,480,576	L27P	probably damaging	Het
Fam135b	T	A	15: 71,464,055	D430V	probably benign	Het
Fam222b	C	T	11: 78,154,603	T202I	possibly damaging	Het
Fmod	T	A	1: 134,041,174	N317K	probably damaging	Het
Frem2	A	G	3: 53,541,093	F2301L	probably damaging	Het
Frem3	T	C	8: 80,611,459	F127S	probably damaging	Het
Gbp7	A	G	3: 142,538,087	S132G	probably benign	Het
Gm4787	A	G	12: 81,378,056	C443R	probably damaging	Het
Grik2	T	C	10: 49,535,341	M5V	possibly damaging	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,555,333	L429F	probably damaging	Het
Lrr1	C	A	12: 69,174,462	T126K	probably benign	Het
Mgat4e	C	A	1: 134,542,028	D93Y	probably damaging	Het
Mllt3	A	T	4: 87,840,781	S343R	possibly damaging	Het
Mms19	T	A	19: 41,944,558	S1031C	probably damaging	Het
Mtrf1	C	T	14: 79,411,650	H237Y	probably damaging	Het
Nckap1l	T	A	15: 103,473,056	L408Q	probably damaging	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr273	A	G	4: 52,856,076	S146P	possibly damaging	Het
Olfr738	T	G	14: 50,413,876	L111V	possibly damaging	Het
Otud7a	T	C	7: 63,735,915	S376P	possibly damaging	Het
Pabpc2	A	T	18: 39,774,269	K196*	probably null	Het
Paqr8	T	A	1: 20,935,413	C264S	probably benign	Het
Pgm2	T	A	4: 99,981,979	F459Y	probably benign	Het
Phip	C	A	9: 82,908,869	V675L	probably benign	Het
Pnma1	T	G	12: 84,147,723	T69P	probably benign	Het
Ptpn12	A	T	5: 21,005,385	C242*	probably null	Het
Rabep1	T	A	11: 70,908,468	V306E	probably benign	Het
Ros1	C	T	10: 52,115,997	D1377N	probably benign	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Scaf11	G	A	15: 96,420,421	Q421*	probably null	Het
Shcbp1	G	A	8: 4,744,512	T427M	probably damaging	Het
Shprh	G	A	10: 11,170,476	R979H	probably damaging	Het
Slc22a27	C	T	19: 7,925,876	C163Y	probably benign	Het
Slc27a1	A	G	8: 71,580,675	D287G	probably damaging	Het
Slc27a1	C	T	8: 71,580,809	T310M	possibly damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc35f2	A	T	9: 53,771,785	M1L	probably benign	Het
Sltm	G	C	9: 70,581,365	R599T	probably damaging	Het
Spic	T	A	10: 88,675,890	Q168L	probably damaging	Het
Spink6	G	A	18: 44,082,361		probably null	Het
Stac2	T	C	11: 98,041,372	E235G	possibly damaging	Het
Szt2	G	A	4: 118,389,191	Q957*	probably null	Het
Them7	A	T	2: 105,378,646	T104S	possibly damaging	Het
Tmed4	T	A	11: 6,271,716	I207F	possibly damaging	Het
Tmem248	A	G	5: 130,236,890	E178G	probably benign	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Trim80	C	A	11: 115,448,138	T598N	possibly damaging	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Vil1	C	T	1: 74,421,266	A194V	probably damaging	Het
Vmn2r61	A	T	7: 42,267,141	M393L	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Vps33b	G	T	7: 80,290,048	A516S	probably damaging	Het
Wisp1	C	A	15: 66,906,640	Y103*	probably null	Het
Zc3h6	G	A	2: 129,002,240	G235R	probably damaging	Het
Zfp612	T	A	8: 110,088,672	D170E	probably benign	Het
Zfp746	A	G	6: 48,064,556	I412T	probably benign	Het

Other mutations in Bptf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Bptf	APN	11	107055279	missense	possibly damaging	0.88
IGL00664:Bptf	APN	11	107077665	missense	possibly damaging	0.78
IGL00705:Bptf	APN	11	107095708	splice site	probably benign
IGL00796:Bptf	APN	11	107054550	missense	probably damaging	1.00
IGL00834:Bptf	APN	11	107073928	missense	possibly damaging	0.59
IGL01155:Bptf	APN	11	107080727	missense	probably damaging	1.00
IGL01314:Bptf	APN	11	107054853	missense	probably damaging	1.00
IGL01371:Bptf	APN	11	107055907	missense	probably benign	0.00
IGL01567:Bptf	APN	11	107058774	missense	probably damaging	1.00
IGL01794:Bptf	APN	11	107053221	critical splice donor site	probably null
IGL02108:Bptf	APN	11	107074988	missense	probably benign	0.45
IGL02367:Bptf	APN	11	107073352	missense	probably benign
IGL02437:Bptf	APN	11	107074695	missense	probably benign	0.00
IGL02589:Bptf	APN	11	107111531	missense	possibly damaging	0.92
IGL02897:Bptf	APN	11	107047121	missense	probably damaging	1.00
IGL02935:Bptf	APN	11	107080799	missense	probably damaging	1.00
IGL02954:Bptf	APN	11	107054749	missense	possibly damaging	0.89
IGL02982:Bptf	APN	11	107076674	missense	probably damaging	1.00
IGL03109:Bptf	APN	11	107061701	missense	possibly damaging	0.53
IGL03265:Bptf	APN	11	107054628	missense	probably benign	0.00
IGL03403:Bptf	APN	11	107099733	missense	possibly damaging	0.51
Anodyne	UTSW	11	107043631	critical splice donor site	probably null
Arroyo	UTSW	11	107042690	missense	probably benign	0.32
mojado	UTSW	11	107044640	missense	probably benign	0.03
IGL03097:Bptf	UTSW	11	107077680	missense	probably damaging	1.00
PIT4486001:Bptf	UTSW	11	107054788	missense	probably damaging	0.98
R0066:Bptf	UTSW	11	107062136	missense	possibly damaging	0.90
R0157:Bptf	UTSW	11	107074658	missense	possibly damaging	0.89
R0320:Bptf	UTSW	11	107072819	missense	probably damaging	1.00
R0328:Bptf	UTSW	11	107047127	missense	probably damaging	1.00
R0402:Bptf	UTSW	11	107074114	missense	probably damaging	1.00
R0482:Bptf	UTSW	11	107081262	missense	probably benign	0.13
R0574:Bptf	UTSW	11	107076527	missense	probably damaging	1.00
R0598:Bptf	UTSW	11	107072965	missense	probably damaging	0.99
R0599:Bptf	UTSW	11	107068382	missense	probably damaging	1.00
R0601:Bptf	UTSW	11	107061692	missense	probably benign	0.04
R0744:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0836:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0885:Bptf	UTSW	11	107043791	missense	probably damaging	1.00
R1070:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1252:Bptf	UTSW	11	107073251	missense	probably benign	0.00
R1370:Bptf	UTSW	11	107047094	missense	probably damaging	0.99
R1428:Bptf	UTSW	11	107073047	missense	probably damaging	0.99
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1742:Bptf	UTSW	11	107110951	missense	probably damaging	1.00
R1816:Bptf	UTSW	11	107060579	missense	probably damaging	1.00
R1858:Bptf	UTSW	11	107073301	missense	probably benign	0.00
R1989:Bptf	UTSW	11	107074826	missense	probably damaging	1.00
R2253:Bptf	UTSW	11	107111322	missense	probably damaging	1.00
R2392:Bptf	UTSW	11	107072747	missense	probably damaging	1.00
R2431:Bptf	UTSW	11	107047240	missense	possibly damaging	0.48
R3022:Bptf	UTSW	11	107111637	critical splice acceptor site	probably null
R3161:Bptf	UTSW	11	107074476	missense	probably damaging	1.00
R3686:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3687:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3688:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3787:Bptf	UTSW	11	107073827	missense	probably damaging	1.00
R3834:Bptf	UTSW	11	107073857	missense	probably benign	0.05
R3885:Bptf	UTSW	11	107074513	missense	probably damaging	0.97
R4090:Bptf	UTSW	11	107081523	missense	probably damaging	0.99
R4398:Bptf	UTSW	11	107110844	missense	probably damaging	1.00
R4437:Bptf	UTSW	11	107074474	missense	possibly damaging	0.59
R4514:Bptf	UTSW	11	107077692	missense	probably damaging	1.00
R4565:Bptf	UTSW	11	107073010	missense	probably damaging	1.00
R4715:Bptf	UTSW	11	107047181	missense	probably damaging	1.00
R4764:Bptf	UTSW	11	107043694	missense	probably damaging	1.00
R4885:Bptf	UTSW	11	107074648	missense	probably benign	0.39
R4901:Bptf	UTSW	11	107110860	nonsense	probably null
R4995:Bptf	UTSW	11	107054565	missense	probably damaging	0.98
R5057:Bptf	UTSW	11	107082528	missense	probably damaging	0.98
R5120:Bptf	UTSW	11	107073385	missense	probably damaging	0.99
R5320:Bptf	UTSW	11	107081367	nonsense	probably null
R5329:Bptf	UTSW	11	107073295	missense	probably benign	0.06
R5418:Bptf	UTSW	11	107111294	missense	probably damaging	1.00
R5461:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R5664:Bptf	UTSW	11	107073699	missense	probably benign	0.01
R5718:Bptf	UTSW	11	107111434	missense	probably damaging	1.00
R5774:Bptf	UTSW	11	107111137	missense	probably damaging	1.00
R5851:Bptf	UTSW	11	107110862	missense	probably damaging	1.00
R5930:Bptf	UTSW	11	107073196	missense	probably damaging	1.00
R5949:Bptf	UTSW	11	107111089	missense	probably damaging	0.99
R5975:Bptf	UTSW	11	107035864	utr 3 prime	probably benign
R6027:Bptf	UTSW	11	107074945	missense	probably damaging	1.00
R6128:Bptf	UTSW	11	107074690	missense	possibly damaging	0.87
R6337:Bptf	UTSW	11	107058779	missense	possibly damaging	0.89
R6407:Bptf	UTSW	11	107111126	missense	probably damaging	1.00
R6470:Bptf	UTSW	11	107072767	missense	probably damaging	1.00
R6487:Bptf	UTSW	11	107077726	missense	probably damaging	0.99
R6501:Bptf	UTSW	11	107077683	missense	probably null	1.00
R6755:Bptf	UTSW	11	107047256	missense	probably benign	0.27
R6861:Bptf	UTSW	11	107062565	missense	probably damaging	1.00
R6866:Bptf	UTSW	11	107073580	missense	probably damaging	1.00
R6879:Bptf	UTSW	11	107042690	missense	probably benign	0.32
R6927:Bptf	UTSW	11	107054595	missense	probably damaging	1.00
R6944:Bptf	UTSW	11	107080823	missense	probably damaging	1.00
R7082:Bptf	UTSW	11	107086747	missense	probably benign	0.00
R7136:Bptf	UTSW	11	107099715	missense	probably damaging	1.00
R7162:Bptf	UTSW	11	107043631	critical splice donor site	probably null
R7171:Bptf	UTSW	11	107131407	missense	unknown
R7193:Bptf	UTSW	11	107054809	nonsense	probably null
R7210:Bptf	UTSW	11	107054464	nonsense	probably null
R7221:Bptf	UTSW	11	107054832	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107073109	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107110914	nonsense	probably null
R7422:Bptf	UTSW	11	107060558	missense	probably damaging	1.00
R7454:Bptf	UTSW	11	107044640	missense	probably benign	0.03
R7657:Bptf	UTSW	11	107074729	missense	probably damaging	1.00
R7718:Bptf	UTSW	11	107081456	missense	possibly damaging	0.65
R7827:Bptf	UTSW	11	107047187	missense	probably benign	0.01
R7844:Bptf	UTSW	11	107074061	missense	probably damaging	0.97
R7992:Bptf	UTSW	11	107110883	missense	probably benign	0.00
R8001:Bptf	UTSW	11	107047340	nonsense	probably null
R8037:Bptf	UTSW	11	107055950	missense	probably damaging	1.00
R8122:Bptf	UTSW	11	107036591	critical splice acceptor site	probably null
R8235:Bptf	UTSW	11	107076632	missense	probably benign	0.04
R8308:Bptf	UTSW	11	107052989	missense	probably damaging	0.99
R8409:Bptf	UTSW	11	107062669	missense	probably damaging	1.00
R8464:Bptf	UTSW	11	107131342	missense	probably benign	0.01
R8477:Bptf	UTSW	11	107052853	missense	probably damaging	0.98
R8482:Bptf	UTSW	11	107043698	missense	probably benign	0.19
R8515:Bptf	UTSW	11	107055238	missense	possibly damaging	0.85
R8519:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R8708:Bptf	UTSW	11	107073313	missense	probably damaging	0.99
R8708:Bptf	UTSW	11	107073314	missense	probably damaging	1.00
R8722:Bptf	UTSW	11	107131469	missense	unknown
R8732:Bptf	UTSW	11	107040380	missense	probably damaging	1.00
R8783:Bptf	UTSW	11	107131531	missense	unknown
R8828:Bptf	UTSW	11	107055010	missense	probably damaging	0.98
R9004:Bptf	UTSW	11	107054887	missense	probably damaging	1.00
R9010:Bptf	UTSW	11	107073750	missense	probably damaging	1.00
R9035:Bptf	UTSW	11	107073016	missense	probably damaging	1.00
R9083:Bptf	UTSW	11	107068350	missense	probably damaging	1.00
R9211:Bptf	UTSW	11	107055298	missense	probably damaging	1.00
R9345:Bptf	UTSW	11	107080762	missense	possibly damaging	0.77
R9393:Bptf	UTSW	11	107074308	missense	probably benign	0.00
R9451:Bptf	UTSW	11	107044585	missense	probably damaging	1.00
R9561:Bptf	UTSW	11	107074128	nonsense	probably null
R9632:Bptf	UTSW	11	107061719	missense	probably damaging	1.00
R9648:Bptf	UTSW	11	107052894	missense	probably damaging	0.99
R9650:Bptf	UTSW	11	107044586	missense	probably benign	0.15
R9658:Bptf	UTSW	11	107111344	missense	probably damaging	1.00
R9775:Bptf	UTSW	11	107043676	missense	probably benign	0.04
R9776:Bptf	UTSW	11	107078570	missense	probably damaging	1.00
Z1088:Bptf	UTSW	11	107074582	missense	probably benign	0.00
Z1176:Bptf	UTSW	11	107058684	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCAAGTAATTCTTTACCCTCAGG -3'
(R):5'- AGATGTTGGATATTAACCACCCC -3'

Sequencing Primer
(F):5'- AGGTTTTCCATGCCCGG -3'
(R):5'- TGGCTATCCTGGAACATGC -3'

Posted On

2015-11-11