Mutagenetix > Incidental Mutation

Incidental Mutation 'R4748:Trim9'

357326

Institutional Source

Beutler Lab

Gene Symbol

Trim9

Ensembl Gene

ENSMUSG00000021071

Gene Name

tripartite motif-containing 9

Synonyms

MMRRC Submission

042030-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R4748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70244533-70347614 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70248273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 688 (N688D)

Ref Sequence

ENSEMBL: ENSMUSP00000152887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000222316] [ENSMUST00000223160]

AlphaFold

Q8C7M3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110520
AA Change: N692D

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: N692D

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART
Pfam:SPRY	598	702	2.4e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110522
AA Change: N766D

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: N766D

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART
low complexity region	591	605	N/A	INTRINSIC
Pfam:SPRY	674	776	1.5e-9	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000221294
AA Change: N738D

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222173

Predicted Effect

probably damaging
Transcript: ENSMUST00000222316
AA Change: N784D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223160
AA Change: N688D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223518

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310009B15Rik	T	A	1: 138,856,656	E54D	possibly damaging	Het
4933415F23Rik	T	C	1: 23,101,870	E121G	probably damaging	Het
Abcb6	C	A	1: 75,177,358	G367W	probably damaging	Het
Asprv1	A	G	6: 86,628,423	M84V	probably damaging	Het
Aspscr1	T	C	11: 120,701,507	V291A	probably damaging	Het
B4galnt4	T	C	7: 141,071,720	F980L	probably damaging	Het
Bpi	G	A	2: 158,272,021	V280I	possibly damaging	Het
Bptf	T	C	11: 107,095,880	D581G	probably damaging	Het
Cap2	T	A	13: 46,639,826	Y223N	possibly damaging	Het
Ccdc141	A	C	2: 77,057,980	I480M	possibly damaging	Het
Ccnh	T	A	13: 85,189,639	V35E	probably benign	Het
Cd6	G	T	19: 10,794,225	S433*	probably null	Het
Ceacam10	A	C	7: 24,781,052	I83L	probably benign	Het
Chek2	T	C	5: 110,855,839		probably null	Het
Chia1	A	T	3: 106,122,449	D73V	probably damaging	Het
Commd2	G	A	3: 57,646,794	T162I	probably benign	Het
Creb3l3	C	T	10: 81,086,047	A316T	probably benign	Het
Cul4a	A	G	8: 13,123,526	K1R	probably benign	Het
Cyp2c23	T	C	19: 44,016,737		probably null	Het
D630045J12Rik	T	C	6: 38,196,841	T131A	possibly damaging	Het
Dctn4	A	C	18: 60,550,236	K295N	probably damaging	Het
Dnah1	A	G	14: 31,319,945	V23A	probably benign	Het
Dync1i1	A	G	6: 5,767,048	K91E	possibly damaging	Het
Dzip1l	A	G	9: 99,642,651	D275G	probably damaging	Het
Enam	C	A	5: 88,501,543	P304T	probably damaging	Het
Enpep	A	G	3: 129,332,163	Y107H	probably damaging	Het
Exd2	T	C	12: 80,480,576	L27P	probably damaging	Het
Fam135b	T	A	15: 71,464,055	D430V	probably benign	Het
Fam222b	C	T	11: 78,154,603	T202I	possibly damaging	Het
Fmod	T	A	1: 134,041,174	N317K	probably damaging	Het
Frem2	A	G	3: 53,541,093	F2301L	probably damaging	Het
Frem3	T	C	8: 80,611,459	F127S	probably damaging	Het
Gbp7	A	G	3: 142,538,087	S132G	probably benign	Het
Gm4787	A	G	12: 81,378,056	C443R	probably damaging	Het
Grik2	T	C	10: 49,535,341	M5V	possibly damaging	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,555,333	L429F	probably damaging	Het
Lrr1	C	A	12: 69,174,462	T126K	probably benign	Het
Mgat4e	C	A	1: 134,542,028	D93Y	probably damaging	Het
Mllt3	A	T	4: 87,840,781	S343R	possibly damaging	Het
Mms19	T	A	19: 41,944,558	S1031C	probably damaging	Het
Mtrf1	C	T	14: 79,411,650	H237Y	probably damaging	Het
Nckap1l	T	A	15: 103,473,056	L408Q	probably damaging	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr273	A	G	4: 52,856,076	S146P	possibly damaging	Het
Olfr738	T	G	14: 50,413,876	L111V	possibly damaging	Het
Otud7a	T	C	7: 63,735,915	S376P	possibly damaging	Het
Pabpc2	A	T	18: 39,774,269	K196*	probably null	Het
Paqr8	T	A	1: 20,935,413	C264S	probably benign	Het
Pgm2	T	A	4: 99,981,979	F459Y	probably benign	Het
Phip	C	A	9: 82,908,869	V675L	probably benign	Het
Pnma1	T	G	12: 84,147,723	T69P	probably benign	Het
Ptpn12	A	T	5: 21,005,385	C242*	probably null	Het
Rabep1	T	A	11: 70,908,468	V306E	probably benign	Het
Ros1	C	T	10: 52,115,997	D1377N	probably benign	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Scaf11	G	A	15: 96,420,421	Q421*	probably null	Het
Shcbp1	G	A	8: 4,744,512	T427M	probably damaging	Het
Shprh	G	A	10: 11,170,476	R979H	probably damaging	Het
Slc22a27	C	T	19: 7,925,876	C163Y	probably benign	Het
Slc27a1	A	G	8: 71,580,675	D287G	probably damaging	Het
Slc27a1	C	T	8: 71,580,809	T310M	possibly damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc35f2	A	T	9: 53,771,785	M1L	probably benign	Het
Sltm	G	C	9: 70,581,365	R599T	probably damaging	Het
Spic	T	A	10: 88,675,890	Q168L	probably damaging	Het
Spink6	G	A	18: 44,082,361		probably null	Het
Stac2	T	C	11: 98,041,372	E235G	possibly damaging	Het
Szt2	G	A	4: 118,389,191	Q957*	probably null	Het
Them7	A	T	2: 105,378,646	T104S	possibly damaging	Het
Tmed4	T	A	11: 6,271,716	I207F	possibly damaging	Het
Tmem248	A	G	5: 130,236,890	E178G	probably benign	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Trim80	C	A	11: 115,448,138	T598N	possibly damaging	Het
Vil1	C	T	1: 74,421,266	A194V	probably damaging	Het
Vmn2r61	A	T	7: 42,267,141	M393L	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Vps33b	G	T	7: 80,290,048	A516S	probably damaging	Het
Wisp1	C	A	15: 66,906,640	Y103*	probably null	Het
Zc3h6	G	A	2: 129,002,240	G235R	probably damaging	Het
Zfp612	T	A	8: 110,088,672	D170E	probably benign	Het
Zfp746	A	G	6: 48,064,556	I412T	probably benign	Het

Other mutations in Trim9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00910:Trim9	APN	12	70347113	missense	probably damaging	0.98
IGL01618:Trim9	APN	12	70248351	missense	probably benign
IGL01794:Trim9	APN	12	70281880	missense	probably damaging	1.00
IGL03101:Trim9	APN	12	70346654	missense	probably damaging	1.00
IGL03184:Trim9	APN	12	70251221	missense	probably damaging	0.99
E0354:Trim9	UTSW	12	70272459	missense	probably benign	0.01
IGL03098:Trim9	UTSW	12	70280693	missense	possibly damaging	0.95
R0518:Trim9	UTSW	12	70346585	missense	probably damaging	0.99
R0622:Trim9	UTSW	12	70346604	missense	probably damaging	1.00
R0941:Trim9	UTSW	12	70248263	missense	probably damaging	0.97
R1022:Trim9	UTSW	12	70252017	splice site	probably null
R1024:Trim9	UTSW	12	70252017	splice site	probably null
R1204:Trim9	UTSW	12	70346727	missense	probably damaging	1.00
R1439:Trim9	UTSW	12	70251093	missense	probably damaging	1.00
R1530:Trim9	UTSW	12	70272428	missense	probably damaging	0.98
R1613:Trim9	UTSW	12	70248395	missense	probably damaging	1.00
R1661:Trim9	UTSW	12	70255113	missense	probably damaging	0.99
R1665:Trim9	UTSW	12	70255113	missense	probably damaging	0.99
R1722:Trim9	UTSW	12	70248374	missense	probably benign	0.33
R2097:Trim9	UTSW	12	70347159	missense	probably damaging	1.00
R3082:Trim9	UTSW	12	70255113	missense	possibly damaging	0.93
R3123:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3124:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3125:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3738:Trim9	UTSW	12	70251195	missense	probably damaging	1.00
R4013:Trim9	UTSW	12	70346352	missense	probably damaging	1.00
R4017:Trim9	UTSW	12	70346352	missense	probably damaging	1.00
R4560:Trim9	UTSW	12	70347118	nonsense	probably null
R4734:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4749:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4777:Trim9	UTSW	12	70347071	missense	probably damaging	1.00
R5027:Trim9	UTSW	12	70346708	missense	probably damaging	0.96
R5451:Trim9	UTSW	12	70346829	missense	probably benign	0.17
R5471:Trim9	UTSW	12	70346792	missense	possibly damaging	0.93
R6394:Trim9	UTSW	12	70255213	missense	possibly damaging	0.91
R6901:Trim9	UTSW	12	70346639	missense	probably damaging	0.96
R7549:Trim9	UTSW	12	70346941	missense	probably damaging	1.00
R7690:Trim9	UTSW	12	70248343	missense	probably benign
R7895:Trim9	UTSW	12	70255187	missense	probably benign	0.03
R8003:Trim9	UTSW	12	70346834	missense	probably benign	0.39
R8026:Trim9	UTSW	12	70290387	missense	probably benign	0.00
R8223:Trim9	UTSW	12	70251015	missense	probably damaging	0.99
R8956:Trim9	UTSW	12	70346891	missense	probably damaging	0.97
R9017:Trim9	UTSW	12	70267239	missense	probably benign
R9475:Trim9	UTSW	12	70346454	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- GTAGAGAAGGCGTCTGTCTC -3'
(R):5'- ATGCAGACTGGTCCAGCAAG -3'

Sequencing Primer
(F):5'- AAGGCGTCTGTCTCCCGTG -3'
(R):5'- TGGTCCAGCAAGCCACAAGG -3'

Posted On

2015-11-11