Incidental Mutation 'R4748:Cap2'
ID 357331
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 042030-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R4748 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46793302 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 223 (Y223N)
Ref Sequence ENSEMBL: ENSMUSP00000112952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably benign
Transcript: ENSMUST00000021802
AA Change: Y335N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: Y335N

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119341
AA Change: Y223N

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: Y223N

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225444
Predicted Effect probably benign
Transcript: ENSMUST00000225824
AA Change: Y280N

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,784,394 (GRCm39) E54D possibly damaging Het
Abcb6 C A 1: 75,154,002 (GRCm39) G367W probably damaging Het
Asprv1 A G 6: 86,605,405 (GRCm39) M84V probably damaging Het
Aspscr1 T C 11: 120,592,333 (GRCm39) V291A probably damaging Het
B4galnt4 T C 7: 140,651,633 (GRCm39) F980L probably damaging Het
Bpi G A 2: 158,113,941 (GRCm39) V280I possibly damaging Het
Bptf T C 11: 106,986,706 (GRCm39) D581G probably damaging Het
Ccdc141 A C 2: 76,888,324 (GRCm39) I480M possibly damaging Het
Ccn4 C A 15: 66,778,489 (GRCm39) Y103* probably null Het
Ccnh T A 13: 85,337,758 (GRCm39) V35E probably benign Het
Cd6 G T 19: 10,771,589 (GRCm39) S433* probably null Het
Ceacam10 A C 7: 24,480,477 (GRCm39) I83L probably benign Het
Chek2 T C 5: 111,003,705 (GRCm39) probably null Het
Chia1 A T 3: 106,029,765 (GRCm39) D73V probably damaging Het
Commd2 G A 3: 57,554,215 (GRCm39) T162I probably benign Het
Creb3l3 C T 10: 80,921,881 (GRCm39) A316T probably benign Het
Cul4a A G 8: 13,173,526 (GRCm39) K1R probably benign Het
Cyp2c23 T C 19: 44,005,176 (GRCm39) probably null Het
D630045J12Rik T C 6: 38,173,776 (GRCm39) T131A possibly damaging Het
Dctn4 A C 18: 60,683,308 (GRCm39) K295N probably damaging Het
Dnah1 A G 14: 31,041,902 (GRCm39) V23A probably benign Het
Dync1i1 A G 6: 5,767,048 (GRCm39) K91E possibly damaging Het
Dzip1l A G 9: 99,524,704 (GRCm39) D275G probably damaging Het
Enam C A 5: 88,649,402 (GRCm39) P304T probably damaging Het
Enpep A G 3: 129,125,812 (GRCm39) Y107H probably damaging Het
Exd2 T C 12: 80,527,350 (GRCm39) L27P probably damaging Het
Fam135b T A 15: 71,335,904 (GRCm39) D430V probably benign Het
Fam222b C T 11: 78,045,429 (GRCm39) T202I possibly damaging Het
Fmod T A 1: 133,968,912 (GRCm39) N317K probably damaging Het
Frem2 A G 3: 53,448,514 (GRCm39) F2301L probably damaging Het
Frem3 T C 8: 81,338,088 (GRCm39) F127S probably damaging Het
Gbp7 A G 3: 142,243,848 (GRCm39) S132G probably benign Het
Gm4787 A G 12: 81,424,830 (GRCm39) C443R probably damaging Het
Grik2 T C 10: 49,411,437 (GRCm39) M5V possibly damaging Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt90 G A 15: 101,463,768 (GRCm39) L429F probably damaging Het
Lrr1 C A 12: 69,221,236 (GRCm39) T126K probably benign Het
Mgat4e C A 1: 134,469,766 (GRCm39) D93Y probably damaging Het
Mllt3 A T 4: 87,759,018 (GRCm39) S343R possibly damaging Het
Mms19 T A 19: 41,932,997 (GRCm39) S1031C probably damaging Het
Mtrf1 C T 14: 79,649,090 (GRCm39) H237Y probably damaging Het
Nckap1l T A 15: 103,381,483 (GRCm39) L408Q probably damaging Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Or11g1 T G 14: 50,651,333 (GRCm39) L111V possibly damaging Het
Or13c3 A G 4: 52,856,076 (GRCm39) S146P possibly damaging Het
Or4a39 C T 2: 89,236,599 (GRCm39) V275I probably benign Het
Or5d36 T A 2: 87,900,956 (GRCm39) I257L probably benign Het
Otud7a T C 7: 63,385,663 (GRCm39) S376P possibly damaging Het
Pabpc2 A T 18: 39,907,322 (GRCm39) K196* probably null Het
Paqr8 T A 1: 21,005,637 (GRCm39) C264S probably benign Het
Pgm1 T A 4: 99,839,176 (GRCm39) F459Y probably benign Het
Phip C A 9: 82,790,922 (GRCm39) V675L probably benign Het
Pnma1 T G 12: 84,194,497 (GRCm39) T69P probably benign Het
Ppp1r14bl T C 1: 23,140,951 (GRCm39) E121G probably damaging Het
Ptpn12 A T 5: 21,210,383 (GRCm39) C242* probably null Het
Rabep1 T A 11: 70,799,294 (GRCm39) V306E probably benign Het
Ros1 C T 10: 51,992,093 (GRCm39) D1377N probably benign Het
Ryr3 T C 2: 112,794,750 (GRCm39) T121A possibly damaging Het
Scaf11 G A 15: 96,318,302 (GRCm39) Q421* probably null Het
Shcbp1 G A 8: 4,794,512 (GRCm39) T427M probably damaging Het
Shprh G A 10: 11,046,220 (GRCm39) R979H probably damaging Het
Slc22a27 C T 19: 7,903,241 (GRCm39) C163Y probably benign Het
Slc27a1 A G 8: 72,033,319 (GRCm39) D287G probably damaging Het
Slc27a1 C T 8: 72,033,453 (GRCm39) T310M possibly damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc35f2 A T 9: 53,679,069 (GRCm39) M1L probably benign Het
Sltm G C 9: 70,488,647 (GRCm39) R599T probably damaging Het
Spic T A 10: 88,511,752 (GRCm39) Q168L probably damaging Het
Spink6 G A 18: 44,215,428 (GRCm39) probably null Het
Stac2 T C 11: 97,932,198 (GRCm39) E235G possibly damaging Het
Szt2 G A 4: 118,246,388 (GRCm39) Q957* probably null Het
Them7 A T 2: 105,208,991 (GRCm39) T104S possibly damaging Het
Tmed4 T A 11: 6,221,716 (GRCm39) I207F possibly damaging Het
Tmem248 A G 5: 130,265,731 (GRCm39) E178G probably benign Het
Tomm40l G A 1: 171,047,131 (GRCm39) R296* probably null Het
Trim80 C A 11: 115,338,964 (GRCm39) T598N possibly damaging Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Vil1 C T 1: 74,460,425 (GRCm39) A194V probably damaging Het
Vmn2r61 A T 7: 41,916,565 (GRCm39) M393L probably damaging Het
Vmn2r63 C T 7: 42,577,544 (GRCm39) M331I probably benign Het
Vps33b G T 7: 79,939,796 (GRCm39) A516S probably damaging Het
Zc3h6 G A 2: 128,844,160 (GRCm39) G235R probably damaging Het
Zfp612 T A 8: 110,815,304 (GRCm39) D170E probably benign Het
Zfp746 A G 6: 48,041,490 (GRCm39) I412T probably benign Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGTGGTTCACTCACAGTC -3'
(R):5'- GAACGAAGCTCTGGTAAACGC -3'

Sequencing Primer
(F):5'- CCTCTGATTACAATCGACATTAAGGC -3'
(R):5'- AGCTCTGGTAAACGCACGGG -3'
Posted On 2015-11-11