Mutagenetix > Incidental Mutation

Incidental Mutation 'R4748:Mtrf1'

357335

Institutional Source

Beutler Lab

Gene Symbol

Mtrf1

Ensembl Gene

ENSMUSG00000022022

Gene Name

mitochondrial translational release factor 1

Synonyms

MMRRC Submission

042030-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R4748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79397772-79423587 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 79411650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 237 (H237Y)

Ref Sequence

ENSEMBL: ENSMUSP00000022600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022600]

AlphaFold

Q8K126

Predicted Effect

probably damaging
Transcript: ENSMUST00000022600
AA Change: H237Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: H237Y

Domain	Start	End	E-Value	Type
low complexity region	104	119	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
PCRF	139	255	5.96e-27	SMART
Pfam:RF-1	290	400	2.6e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227610

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310009B15Rik	T	A	1: 138,856,656	E54D	possibly damaging	Het
4933415F23Rik	T	C	1: 23,101,870	E121G	probably damaging	Het
Abcb6	C	A	1: 75,177,358	G367W	probably damaging	Het
Asprv1	A	G	6: 86,628,423	M84V	probably damaging	Het
Aspscr1	T	C	11: 120,701,507	V291A	probably damaging	Het
B4galnt4	T	C	7: 141,071,720	F980L	probably damaging	Het
Bpi	G	A	2: 158,272,021	V280I	possibly damaging	Het
Bptf	T	C	11: 107,095,880	D581G	probably damaging	Het
Cap2	T	A	13: 46,639,826	Y223N	possibly damaging	Het
Ccdc141	A	C	2: 77,057,980	I480M	possibly damaging	Het
Ccnh	T	A	13: 85,189,639	V35E	probably benign	Het
Cd6	G	T	19: 10,794,225	S433*	probably null	Het
Ceacam10	A	C	7: 24,781,052	I83L	probably benign	Het
Chek2	T	C	5: 110,855,839		probably null	Het
Chia1	A	T	3: 106,122,449	D73V	probably damaging	Het
Commd2	G	A	3: 57,646,794	T162I	probably benign	Het
Creb3l3	C	T	10: 81,086,047	A316T	probably benign	Het
Cul4a	A	G	8: 13,123,526	K1R	probably benign	Het
Cyp2c23	T	C	19: 44,016,737		probably null	Het
D630045J12Rik	T	C	6: 38,196,841	T131A	possibly damaging	Het
Dctn4	A	C	18: 60,550,236	K295N	probably damaging	Het
Dnah1	A	G	14: 31,319,945	V23A	probably benign	Het
Dync1i1	A	G	6: 5,767,048	K91E	possibly damaging	Het
Dzip1l	A	G	9: 99,642,651	D275G	probably damaging	Het
Enam	C	A	5: 88,501,543	P304T	probably damaging	Het
Enpep	A	G	3: 129,332,163	Y107H	probably damaging	Het
Exd2	T	C	12: 80,480,576	L27P	probably damaging	Het
Fam135b	T	A	15: 71,464,055	D430V	probably benign	Het
Fam222b	C	T	11: 78,154,603	T202I	possibly damaging	Het
Fmod	T	A	1: 134,041,174	N317K	probably damaging	Het
Frem2	A	G	3: 53,541,093	F2301L	probably damaging	Het
Frem3	T	C	8: 80,611,459	F127S	probably damaging	Het
Gbp7	A	G	3: 142,538,087	S132G	probably benign	Het
Gm4787	A	G	12: 81,378,056	C443R	probably damaging	Het
Grik2	T	C	10: 49,535,341	M5V	possibly damaging	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,555,333	L429F	probably damaging	Het
Lrr1	C	A	12: 69,174,462	T126K	probably benign	Het
Mgat4e	C	A	1: 134,542,028	D93Y	probably damaging	Het
Mllt3	A	T	4: 87,840,781	S343R	possibly damaging	Het
Mms19	T	A	19: 41,944,558	S1031C	probably damaging	Het
Nckap1l	T	A	15: 103,473,056	L408Q	probably damaging	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr273	A	G	4: 52,856,076	S146P	possibly damaging	Het
Olfr738	T	G	14: 50,413,876	L111V	possibly damaging	Het
Otud7a	T	C	7: 63,735,915	S376P	possibly damaging	Het
Pabpc2	A	T	18: 39,774,269	K196*	probably null	Het
Paqr8	T	A	1: 20,935,413	C264S	probably benign	Het
Pgm2	T	A	4: 99,981,979	F459Y	probably benign	Het
Phip	C	A	9: 82,908,869	V675L	probably benign	Het
Pnma1	T	G	12: 84,147,723	T69P	probably benign	Het
Ptpn12	A	T	5: 21,005,385	C242*	probably null	Het
Rabep1	T	A	11: 70,908,468	V306E	probably benign	Het
Ros1	C	T	10: 52,115,997	D1377N	probably benign	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Scaf11	G	A	15: 96,420,421	Q421*	probably null	Het
Shcbp1	G	A	8: 4,744,512	T427M	probably damaging	Het
Shprh	G	A	10: 11,170,476	R979H	probably damaging	Het
Slc22a27	C	T	19: 7,925,876	C163Y	probably benign	Het
Slc27a1	C	T	8: 71,580,809	T310M	possibly damaging	Het
Slc27a1	A	G	8: 71,580,675	D287G	probably damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc35f2	A	T	9: 53,771,785	M1L	probably benign	Het
Sltm	G	C	9: 70,581,365	R599T	probably damaging	Het
Spic	T	A	10: 88,675,890	Q168L	probably damaging	Het
Spink6	G	A	18: 44,082,361		probably null	Het
Stac2	T	C	11: 98,041,372	E235G	possibly damaging	Het
Szt2	G	A	4: 118,389,191	Q957*	probably null	Het
Them7	A	T	2: 105,378,646	T104S	possibly damaging	Het
Tmed4	T	A	11: 6,271,716	I207F	possibly damaging	Het
Tmem248	A	G	5: 130,236,890	E178G	probably benign	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Trim80	C	A	11: 115,448,138	T598N	possibly damaging	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Vil1	C	T	1: 74,421,266	A194V	probably damaging	Het
Vmn2r61	A	T	7: 42,267,141	M393L	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Vps33b	G	T	7: 80,290,048	A516S	probably damaging	Het
Wisp1	C	A	15: 66,906,640	Y103*	probably null	Het
Zc3h6	G	A	2: 129,002,240	G235R	probably damaging	Het
Zfp612	T	A	8: 110,088,672	D170E	probably benign	Het
Zfp746	A	G	6: 48,064,556	I412T	probably benign	Het

Other mutations in Mtrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:Mtrf1	APN	14	79423425	missense	probably benign	0.10
IGL01478:Mtrf1	APN	14	79402920	splice site	probably benign
IGL01866:Mtrf1	APN	14	79401508	missense	probably benign
IGL02290:Mtrf1	APN	14	79401811	nonsense	probably null
IGL02929:Mtrf1	APN	14	79402833	missense	probably benign	0.00
IGL03342:Mtrf1	APN	14	79415980	missense	possibly damaging	0.80
IGL03342:Mtrf1	APN	14	79415871	splice site	probably benign
IGL03342:Mtrf1	APN	14	79415872	splice site	probably null
R0212:Mtrf1	UTSW	14	79419279	missense	probably benign	0.02
R0560:Mtrf1	UTSW	14	79406850	missense	probably damaging	1.00
R0604:Mtrf1	UTSW	14	79415887	missense	possibly damaging	0.92
R0669:Mtrf1	UTSW	14	79419268	nonsense	probably null
R0981:Mtrf1	UTSW	14	79401590	missense	probably benign	0.04
R1837:Mtrf1	UTSW	14	79401833	missense	possibly damaging	0.89
R1969:Mtrf1	UTSW	14	79401671	missense	probably damaging	1.00
R3883:Mtrf1	UTSW	14	79419267	missense	probably damaging	1.00
R4739:Mtrf1	UTSW	14	79413080	missense	probably damaging	1.00
R4780:Mtrf1	UTSW	14	79401688	missense	probably benign	0.02
R4965:Mtrf1	UTSW	14	79406587	missense	probably benign
R5616:Mtrf1	UTSW	14	79401445	missense	possibly damaging	0.68
R6530:Mtrf1	UTSW	14	79402891	missense	possibly damaging	0.89
R6776:Mtrf1	UTSW	14	79413081	missense	probably damaging	1.00
R7095:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7182:Mtrf1	UTSW	14	79423464	missense	possibly damaging	0.60
R7254:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7871:Mtrf1	UTSW	14	79406938	missense	probably benign	0.19
R8249:Mtrf1	UTSW	14	79401479	missense	probably benign	0.23
R9593:Mtrf1	UTSW	14	79419224	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCCAGATGTTACCTACAGC -3'
(R):5'- ACCTCATCTGGCTGTGGAAG -3'

Sequencing Primer
(F):5'- TCCCAGCATTCAAGAGGTTG -3'
(R):5'- GGAAGGACAATCACTGACATTGTTCC -3'

Posted On

2015-11-11