Incidental Mutation 'R4748:Mms19'
ID357346
Institutional Source Beutler Lab
Gene Symbol Mms19
Ensembl Gene ENSMUSG00000025159
Gene NameMMS19 (MET18 S. cerevisiae)
SynonymsMms19, 2610042O15Rik, C86341, Mms19l
MMRRC Submission 042030-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4748 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41941086-41981157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41944558 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1031 (S1031C)
Ref Sequence ENSEMBL: ENSMUSP00000130900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026154] [ENSMUST00000026168] [ENSMUST00000163287] [ENSMUST00000163398] [ENSMUST00000164776] [ENSMUST00000167820] [ENSMUST00000167927] [ENSMUST00000169775] [ENSMUST00000171561] [ENSMUST00000223802] [ENSMUST00000224562] [ENSMUST00000225968]
Predicted Effect probably benign
Transcript: ENSMUST00000026154
SMART Domains Protein: ENSMUSP00000026154
Gene: ENSMUSG00000025157

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 115 137 N/A INTRINSIC
Pfam:zf-DHHC 151 289 1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026168
AA Change: S988C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026168
Gene: ENSMUSG00000025159
AA Change: S988C

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.4e-29 PFAM
Pfam:MMS19_N 163 270 2.4e-44 PFAM
low complexity region 329 343 N/A INTRINSIC
Pfam:MMS19_C 484 921 4.3e-120 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163287
AA Change: S885C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128653
Gene: ENSMUSG00000025159
AA Change: S885C

DomainStartEndE-ValueType
Pfam:MMS19_N 3 265 9.8e-97 PFAM
Pfam:MMS19_C 381 818 1e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163398
Predicted Effect probably benign
Transcript: ENSMUST00000164776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165043
Predicted Effect probably benign
Transcript: ENSMUST00000166090
SMART Domains Protein: ENSMUSP00000131219
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_C 102 494 2.2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167820
SMART Domains Protein: ENSMUSP00000130399
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_C 63 286 7.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167927
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169775
SMART Domains Protein: ENSMUSP00000128234
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170209
Predicted Effect probably damaging
Transcript: ENSMUST00000171561
AA Change: S1031C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159
AA Change: S1031C

DomainStartEndE-ValueType
Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223785
Predicted Effect probably benign
Transcript: ENSMUST00000223802
Predicted Effect probably benign
Transcript: ENSMUST00000224537
Predicted Effect probably benign
Transcript: ENSMUST00000224562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225433
Predicted Effect probably benign
Transcript: ENSMUST00000225968
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,856,656 E54D possibly damaging Het
4933415F23Rik T C 1: 23,101,870 E121G probably damaging Het
Abcb6 C A 1: 75,177,358 G367W probably damaging Het
Asprv1 A G 6: 86,628,423 M84V probably damaging Het
Aspscr1 T C 11: 120,701,507 V291A probably damaging Het
B4galnt4 T C 7: 141,071,720 F980L probably damaging Het
Bpi G A 2: 158,272,021 V280I possibly damaging Het
Bptf T C 11: 107,095,880 D581G probably damaging Het
Cap2 T A 13: 46,639,826 Y223N possibly damaging Het
Ccdc141 A C 2: 77,057,980 I480M possibly damaging Het
Ccnh T A 13: 85,189,639 V35E probably benign Het
Cd6 G T 19: 10,794,225 S433* probably null Het
Ceacam10 A C 7: 24,781,052 I83L probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Chia1 A T 3: 106,122,449 D73V probably damaging Het
Commd2 G A 3: 57,646,794 T162I probably benign Het
Creb3l3 C T 10: 81,086,047 A316T probably benign Het
Cul4a A G 8: 13,123,526 K1R probably benign Het
Cyp2c23 T C 19: 44,016,737 probably null Het
D630045J12Rik T C 6: 38,196,841 T131A possibly damaging Het
Dctn4 A C 18: 60,550,236 K295N probably damaging Het
Dnah1 A G 14: 31,319,945 V23A probably benign Het
Dync1i1 A G 6: 5,767,048 K91E possibly damaging Het
Dzip1l A G 9: 99,642,651 D275G probably damaging Het
Enam C A 5: 88,501,543 P304T probably damaging Het
Enpep A G 3: 129,332,163 Y107H probably damaging Het
Exd2 T C 12: 80,480,576 L27P probably damaging Het
Fam135b T A 15: 71,464,055 D430V probably benign Het
Fam222b C T 11: 78,154,603 T202I possibly damaging Het
Fmod T A 1: 134,041,174 N317K probably damaging Het
Frem2 A G 3: 53,541,093 F2301L probably damaging Het
Frem3 T C 8: 80,611,459 F127S probably damaging Het
Gbp7 A G 3: 142,538,087 S132G probably benign Het
Gm4787 A G 12: 81,378,056 C443R probably damaging Het
Grik2 T C 10: 49,535,341 M5V possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,555,333 L429F probably damaging Het
Lrr1 C A 12: 69,174,462 T126K probably benign Het
Mgat4e C A 1: 134,542,028 D93Y probably damaging Het
Mllt3 A T 4: 87,840,781 S343R possibly damaging Het
Mtrf1 C T 14: 79,411,650 H237Y probably damaging Het
Nckap1l T A 15: 103,473,056 L408Q probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr273 A G 4: 52,856,076 S146P possibly damaging Het
Olfr738 T G 14: 50,413,876 L111V possibly damaging Het
Otud7a T C 7: 63,735,915 S376P possibly damaging Het
Pabpc2 A T 18: 39,774,269 K196* probably null Het
Paqr8 T A 1: 20,935,413 C264S probably benign Het
Pgm2 T A 4: 99,981,979 F459Y probably benign Het
Phip C A 9: 82,908,869 V675L probably benign Het
Pnma1 T G 12: 84,147,723 T69P probably benign Het
Ptpn12 A T 5: 21,005,385 C242* probably null Het
Rabep1 T A 11: 70,908,468 V306E probably benign Het
Ros1 C T 10: 52,115,997 D1377N probably benign Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Scaf11 G A 15: 96,420,421 Q421* probably null Het
Shcbp1 G A 8: 4,744,512 T427M probably damaging Het
Shprh G A 10: 11,170,476 R979H probably damaging Het
Slc22a27 C T 19: 7,925,876 C163Y probably benign Het
Slc27a1 A G 8: 71,580,675 D287G probably damaging Het
Slc27a1 C T 8: 71,580,809 T310M possibly damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc35f2 A T 9: 53,771,785 M1L probably benign Het
Sltm G C 9: 70,581,365 R599T probably damaging Het
Spic T A 10: 88,675,890 Q168L probably damaging Het
Spink6 G A 18: 44,082,361 probably null Het
Stac2 T C 11: 98,041,372 E235G possibly damaging Het
Szt2 G A 4: 118,389,191 Q957* probably null Het
Them7 A T 2: 105,378,646 T104S possibly damaging Het
Tmed4 T A 11: 6,271,716 I207F possibly damaging Het
Tmem248 A G 5: 130,236,890 E178G probably benign Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Trim80 C A 11: 115,448,138 T598N possibly damaging Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Vil1 C T 1: 74,421,266 A194V probably damaging Het
Vmn2r61 A T 7: 42,267,141 M393L probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Vps33b G T 7: 80,290,048 A516S probably damaging Het
Wisp1 C A 15: 66,906,640 Y103* probably null Het
Zc3h6 G A 2: 129,002,240 G235R probably damaging Het
Zfp612 T A 8: 110,088,672 D170E probably benign Het
Zfp746 A G 6: 48,064,556 I412T probably benign Het
Other mutations in Mms19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Mms19 APN 19 41948233 missense probably benign 0.12
IGL00157:Mms19 APN 19 41945457 critical splice donor site probably null
IGL01997:Mms19 APN 19 41956531 missense probably damaging 1.00
IGL02081:Mms19 APN 19 41949979 critical splice donor site probably null
IGL02171:Mms19 APN 19 41957139 critical splice donor site probably null
IGL02306:Mms19 APN 19 41966264 missense probably damaging 1.00
IGL02678:Mms19 APN 19 41954476 missense possibly damaging 0.84
IGL02795:Mms19 APN 19 41952406 critical splice donor site probably null
IGL03233:Mms19 APN 19 41946913 splice site probably null
IGL03250:Mms19 APN 19 41954464 critical splice donor site probably null
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0480:Mms19 UTSW 19 41954846 missense probably damaging 0.98
R0498:Mms19 UTSW 19 41949773 missense possibly damaging 0.82
R0505:Mms19 UTSW 19 41953734 missense probably damaging 1.00
R0547:Mms19 UTSW 19 41963418 missense probably damaging 0.99
R1102:Mms19 UTSW 19 41950845 missense possibly damaging 0.77
R1183:Mms19 UTSW 19 41954831 missense possibly damaging 0.83
R1544:Mms19 UTSW 19 41955821 critical splice donor site probably null
R1666:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1668:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1808:Mms19 UTSW 19 41966259 missense probably damaging 1.00
R1827:Mms19 UTSW 19 41953677 missense probably benign 0.00
R3055:Mms19 UTSW 19 41950088 splice site probably benign
R3551:Mms19 UTSW 19 41949798 missense probably benign 0.04
R3716:Mms19 UTSW 19 41944735 missense probably damaging 1.00
R3877:Mms19 UTSW 19 41966256 nonsense probably null
R4288:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4289:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4445:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4446:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4610:Mms19 UTSW 19 41945496 missense possibly damaging 0.91
R4734:Mms19 UTSW 19 41944558 missense probably damaging 1.00
R5315:Mms19 UTSW 19 41954762 missense possibly damaging 0.68
R5492:Mms19 UTSW 19 41955831 missense possibly damaging 0.91
R5621:Mms19 UTSW 19 41966313 missense probably benign 0.27
R5643:Mms19 UTSW 19 41955866 missense possibly damaging 0.87
R5769:Mms19 UTSW 19 41964386 missense probably damaging 1.00
R6567:Mms19 UTSW 19 41949767 critical splice donor site probably null
R6569:Mms19 UTSW 19 41964368 missense possibly damaging 0.93
R6588:Mms19 UTSW 19 41966276 missense probably damaging 1.00
R6645:Mms19 UTSW 19 41955191 missense probably benign 0.04
R6696:Mms19 UTSW 19 41954013 missense probably benign 0.41
R7050:Mms19 UTSW 19 41950746 splice site probably null
R7426:Mms19 UTSW 19 41948278 missense probably benign
R7564:Mms19 UTSW 19 41947016 missense probably benign 0.09
R7655:Mms19 UTSW 19 41944572 missense probably damaging 0.98
R7656:Mms19 UTSW 19 41944572 missense probably damaging 0.98
R7687:Mms19 UTSW 19 41955168 missense possibly damaging 0.85
R7729:Mms19 UTSW 19 41952465 nonsense probably null
Z1177:Mms19 UTSW 19 41957140 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATTCCTGACAGACACGGGAG -3'
(R):5'- TCAGGTCATCCGAGCCTTAG -3'

Sequencing Primer
(F):5'- CCAAGGTCTTTTCCTCAAATACAAG -3'
(R):5'- GTCATCCGAGCCTTAGCCAAG -3'
Posted On2015-11-11