Mutagenetix > Incidental Mutation

Incidental Mutation 'R4749:Kif21b'

357350

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

N-5 kinesin, 2610511N21Rik

MMRRC Submission

041969-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R4749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136131389-136177998 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 136144749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 64 (Y64*)

Ref Sequence

ENSEMBL: ENSMUSP00000114297 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000075164
AA Change: Y64*

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: Y64*

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122892

Predicted Effect

probably null
Transcript: ENSMUST00000130864
AA Change: Y64*

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: Y64*

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	T	19: 57,215,721	D79E	probably benign	Het
Adgra2	A	G	8: 27,114,197	K472E	probably damaging	Het
Akap9	A	G	5: 3,968,737	D1106G	probably benign	Het
Arhgap35	T	C	7: 16,498,626	E1367G	possibly damaging	Het
Arsi	A	T	18: 60,917,461	Y472F	probably benign	Het
Asxl3	A	G	18: 22,516,769	D605G	probably damaging	Het
Atp6v1e2	C	T	17: 86,944,707	D88N	probably benign	Het
BC061237	T	A	14: 44,506,012	V169E	probably damaging	Het
C1galt1	A	G	6: 7,866,379	E75G	probably benign	Het
C530008M17Rik	T	C	5: 76,858,834	V1014A	unknown	Het
C9	G	A	15: 6,489,830	V383I	probably benign	Het
Ccdc88a	A	G	11: 29,482,720	K222R	probably benign	Het
Ccna2	T	C	3: 36,566,242	S421G	probably benign	Het
Cflar	T	G	1: 58,740,272	V229G	possibly damaging	Het
Clcn1	A	G	6: 42,290,197		probably null	Het
Col14a1	T	A	15: 55,452,336	F1342L	unknown	Het
Colq	C	T	14: 31,529,515	R313H	possibly damaging	Het
Coro6	A	G	11: 77,469,148	E345G	probably damaging	Het
Cyb561	A	G	11: 105,935,882	F182L	probably benign	Het
Dap3	A	G	3: 88,926,310	S317P	probably benign	Het
Dnah9	G	A	11: 65,834,115	A4404V	probably damaging	Het
Dsg4	A	G	18: 20,446,831	E31G	possibly damaging	Het
Dsn1	G	A	2: 157,001,740	L147F	probably damaging	Het
Dysf	T	C	6: 84,067,008	V277A	probably damaging	Het
Eprs	T	A	1: 185,396,130	I569K	probably damaging	Het
Erg	T	C	16: 95,361,170	N342S	probably damaging	Het
Fam114a1	G	A	5: 65,009,066	D247N	probably damaging	Het
Fat2	A	G	11: 55,311,468	V260A	probably benign	Het
Foxn4	T	C	5: 114,255,567	D497G	probably damaging	Het
Fsip2	A	G	2: 82,989,285	I5121V	probably benign	Het
Gcn1l1	T	A	5: 115,614,402	D2155E	probably benign	Het
Glra1	C	A	11: 55,536,384	D42Y	probably damaging	Het
Gpr171	A	G	3: 59,097,466	V296A	probably benign	Het
Grid1	T	A	14: 35,580,687	S970T	possibly damaging	Het
Hcn3	A	T	3: 89,150,063		probably null	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Hsd3b3	G	A	3: 98,742,615	P131S	probably damaging	Het
Hsp90b1	A	G	10: 86,701,808	V211A	probably damaging	Het
Htr2c	A	G	X: 147,193,797	T163A	probably benign	Het
Ifi208	T	A	1: 173,695,614	D483E	possibly damaging	Het
Kbtbd6	T	A	14: 79,453,287	V474E	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Map3k10	T	C	7: 27,658,361	D664G	possibly damaging	Het
Map3k5	C	A	10: 20,132,052	S1201Y	probably benign	Het
Mcm2	T	C	6: 88,891,991	E293G	possibly damaging	Het
Med21	T	A	6: 146,650,101		probably null	Het
Mettl18	T	C	1: 163,996,785	V225A	probably benign	Het
Mmp10	A	T	9: 7,508,168	I432F	probably damaging	Het
Muc5b	T	G	7: 141,861,448	Y2710*	probably null	Het
Neurl4	A	T	11: 69,911,068	I1282F	probably benign	Het
Nipbl	A	T	15: 8,365,829	H191Q	possibly damaging	Het
Nktr	A	G	9: 121,741,693	D167G	probably damaging	Het
Nrap	A	G	19: 56,380,237	I249T	probably damaging	Het
Nsfl1c	A	G	2: 151,509,606	T297A	probably benign	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr1449	C	T	19: 12,935,217	H160Y	probably benign	Het
Olfr20	G	A	11: 73,354,496	V248M	probably damaging	Het
Olfr731	A	G	14: 50,238,733	S51P	probably damaging	Het
Pcnx2	T	C	8: 125,887,588	S375G	probably damaging	Het
Phf2	A	T	13: 48,821,709		probably null	Het
Piezo1	G	T	8: 122,498,206	Q654K	probably damaging	Het
Piezo1	A	T	8: 122,486,939	M1739K	possibly damaging	Het
Pml	C	T	9: 58,234,652	R299H	probably damaging	Het
Ppp3cb	A	T	14: 20,524,062	M236K	probably damaging	Het
Prkch	T	A	12: 73,692,960	C203S	probably damaging	Het
Prob1	C	T	18: 35,652,816	R795H	possibly damaging	Het
Prr22	G	C	17: 56,771,274	E142D	possibly damaging	Het
Prss56	C	A	1: 87,185,583	A211E	possibly damaging	Het
Qser1	A	C	2: 104,787,304	S1054R	probably benign	Het
Rhbdl2	T	C	4: 123,826,901		probably null	Het
Rhot2	C	A	17: 25,844,274	G19V	probably damaging	Het
Rp1l1	C	T	14: 64,029,800	T945M	probably damaging	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Sdad1	C	T	5: 92,304,977	R134Q	possibly damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Sharpin	T	A	15: 76,347,567	D314V	probably damaging	Het
Slc14a2	A	T	18: 78,155,581	L778Q	probably damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc4a11	C	A	2: 130,690,867	R222L	probably damaging	Het
Slc7a10	C	T	7: 35,200,762	P502S	probably damaging	Het
Sort1	T	G	3: 108,356,323	Y812*	probably null	Het
Spata31d1b	G	A	13: 59,718,358	V1107M	probably damaging	Het
Tcp10b	G	A	17: 13,070,945		probably null	Het
Tmem8	T	C	17: 26,116,783	F48S	probably damaging	Het
Tnc	T	C	4: 63,995,639	D1312G	possibly damaging	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Topors	A	T	4: 40,261,015	S756R	unknown	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Ube2o	T	C	11: 116,541,908	D744G	probably benign	Het
Vmn1r224	A	G	17: 20,419,751	I197V	probably benign	Het
Zc3h18	A	T	8: 122,383,643	D77V	probably damaging	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136152342	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136154094	splice site	probably benign
IGL01288:Kif21b	APN	1	136172184	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136171303	missense	probably benign
IGL02264:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136151267	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136154121	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136172867	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136172230	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136158355	unclassified	probably benign
IGL03230:Kif21b	APN	1	136162812	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136172157	critical splice acceptor site	probably null
Schiessen	UTSW	1	136147869	critical splice donor site	probably null
wolfen	UTSW	1	136144758	nonsense	probably null
R0190:Kif21b	UTSW	1	136171219	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136149311	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136163099	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136159428	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136172157	critical splice acceptor site	probably null
R0741:Kif21b	UTSW	1	136159744	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136162823	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136152376	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136169324	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136152805	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136156111	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136149317	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136171685	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136171220	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136171285	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136156142	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136147793	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136147845	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136171156	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136161770	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136148282	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136160313	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136172966	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136147874	splice site	probably benign
R2896:Kif21b	UTSW	1	136154217	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136159410	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136156226	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136162994	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136154093	splice site	probably null
R4600:Kif21b	UTSW	1	136147864	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136148186	intron	probably benign
R4841:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136151325	splice site	probably null
R4959:Kif21b	UTSW	1	136148370	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136172234	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136152783	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136163100	missense	probably benign
R5197:Kif21b	UTSW	1	136144625	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136171673	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136169228	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136171143	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136172292	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136147525	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136170059	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136170009	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136151137	nonsense	probably null
R5929:Kif21b	UTSW	1	136151207	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136149418	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136158326	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136152397	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136144758	nonsense	probably null
R7156:Kif21b	UTSW	1	136147824	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136149448	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136159649	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136147869	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136171173	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136172283	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136145304	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136151155	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136172821	nonsense	probably null
R9261:Kif21b	UTSW	1	136149424	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136171707	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136174062	missense	probably benign
R9562:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136149428	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136153223	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136148683	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136158341	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136149316	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136154137	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136148312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAACCGAATTATGGCTGGTAAC -3'
(R):5'- CAATGGGCCTTGAGTGACTG -3'

Sequencing Primer
(F):5'- AAGAGGATGGTCTGTCACTTCTACC -3'
(R):5'- GGCCTTGAGTGACTGCTCTC -3'

Posted On

2015-11-11