Incidental Mutation 'R4749:Dap3'
ID357368
Institutional Source Beutler Lab
Gene Symbol Dap3
Ensembl Gene ENSMUSG00000068921
Gene Namedeath associated protein 3
SynonymsDAP-3, 4921514D13Rik
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4749 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88920803-88951181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88926310 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 317 (S317P)
Ref Sequence ENSEMBL: ENSMUSP00000088456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090938] [ENSMUST00000107491] [ENSMUST00000172942] [ENSMUST00000173021] [ENSMUST00000173135] [ENSMUST00000174077] [ENSMUST00000174402]
Predicted Effect probably benign
Transcript: ENSMUST00000090938
AA Change: S317P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088456
Gene: ENSMUSG00000068921
AA Change: S317P

DomainStartEndE-ValueType
Pfam:DAP3 97 392 2.1e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107491
SMART Domains Protein: ENSMUSP00000103115
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 97 306 1e-67 PFAM
Pfam:DAP3 300 362 6.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172942
SMART Domains Protein: ENSMUSP00000134145
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 63 133 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173021
SMART Domains Protein: ENSMUSP00000133314
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 200 2.4e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173094
AA Change: S175P
SMART Domains Protein: ENSMUSP00000133486
Gene: ENSMUSG00000068921
AA Change: S175P

DomainStartEndE-ValueType
Pfam:DAP3 9 140 6.5e-48 PFAM
Pfam:DAP3 134 251 4.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173135
AA Change: S312P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134422
Gene: ENSMUSG00000068921
AA Change: S312P

DomainStartEndE-ValueType
Pfam:DAP3 92 387 8e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173711
Predicted Effect probably benign
Transcript: ENSMUST00000174077
SMART Domains Protein: ENSMUSP00000134433
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 212 7.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174402
SMART Domains Protein: ENSMUSP00000133395
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 79 165 1.7e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174571
AA Change: S137P
SMART Domains Protein: ENSMUSP00000133349
Gene: ENSMUSG00000068921
AA Change: S137P

DomainStartEndE-ValueType
Pfam:DAP3 1 102 4.7e-36 PFAM
Pfam:DAP3 99 213 7e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality with defects in mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Dap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Dap3 APN 3 88936228 missense probably benign 0.23
IGL02111:Dap3 APN 3 88929418 missense probably benign 0.26
IGL02453:Dap3 APN 3 88928327 missense probably benign 0.07
IGL02989:Dap3 APN 3 88930571 splice site probably benign
R0094:Dap3 UTSW 3 88927028 missense probably benign 0.01
R0665:Dap3 UTSW 3 88930997 nonsense probably null
R1853:Dap3 UTSW 3 88930926 missense probably damaging 1.00
R1885:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R1887:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R2351:Dap3 UTSW 3 88933563 critical splice donor site probably null
R2513:Dap3 UTSW 3 88928258 missense probably benign 0.15
R4449:Dap3 UTSW 3 88949878 unclassified probably benign
R5359:Dap3 UTSW 3 88930989 missense probably damaging 1.00
R5502:Dap3 UTSW 3 88925326 missense probably damaging 1.00
R6899:Dap3 UTSW 3 88933600 missense probably benign 0.01
R6919:Dap3 UTSW 3 88930989 missense probably damaging 0.98
R6946:Dap3 UTSW 3 88938216 start gained probably benign
R7990:Dap3 UTSW 3 88928507 nonsense probably null
R8188:Dap3 UTSW 3 88936236 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAAGAGACAGTCCCTTAGC -3'
(R):5'- TTTGCTCAGCCACTGTCATGAC -3'

Sequencing Primer
(F):5'- AGAGACAGTCCCTTAGCTCAGTG -3'
(R):5'- CATGACAGTGTTGTGAGACAGTCTAC -3'
Posted On2015-11-11