Incidental Mutation 'R4749:Akap9'
ID 357376
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene Name A kinase (PRKA) anchor protein (yotiao) 9
Synonyms AKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock # R4749 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 3928054-4081310 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3968737 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1106 (D1106G)
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044492
AA Change: D1106G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: D1106G

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123119
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
Andy UTSW 5 3961764 nonsense probably null
blimey UTSW 5 4070397 nonsense probably null
hoarder UTSW 5 4069089 missense probably benign 0.00
marinarum UTSW 5 4013875 nonsense probably null
miser UTSW 5 4046064 missense probably benign 0.13
naviculus UTSW 5 3960865 missense probably damaging 0.98
thrifty UTSW 5 3976209 missense probably damaging 0.99
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 splice site probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 splice site probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 splice site probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7192:Akap9 UTSW 5 4005723 splice site probably null
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4046364 missense probably damaging 0.99
R7455:Akap9 UTSW 5 3972792 missense probably benign 0.03
R7482:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7489:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7525:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7528:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7576:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7577:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7578:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7610:Akap9 UTSW 5 3957677 missense possibly damaging 0.95
R7658:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7754:Akap9 UTSW 5 4046736 missense probably benign 0.03
R7818:Akap9 UTSW 5 4013875 nonsense probably null
R7979:Akap9 UTSW 5 4050381 missense probably benign
R7991:Akap9 UTSW 5 4064949 splice site probably null
R8036:Akap9 UTSW 5 4070397 nonsense probably null
R8054:Akap9 UTSW 5 4038707 critical splice donor site probably null
R8116:Akap9 UTSW 5 4061183 missense probably benign 0.04
R8150:Akap9 UTSW 5 3961982 missense probably damaging 1.00
R8234:Akap9 UTSW 5 4044845 missense probably benign 0.18
R8348:Akap9 UTSW 5 3948897 critical splice donor site probably null
R8365:Akap9 UTSW 5 3968745 missense probably benign 0.04
R8366:Akap9 UTSW 5 3968745 missense probably benign 0.04
R8448:Akap9 UTSW 5 3948897 critical splice donor site probably null
R8466:Akap9 UTSW 5 4038659 missense probably damaging 1.00
R8772:Akap9 UTSW 5 4046255 missense probably damaging 1.00
R8881:Akap9 UTSW 5 3961279 missense
R8937:Akap9 UTSW 5 4044048 missense possibly damaging 0.78
R8956:Akap9 UTSW 5 3948805 missense possibly damaging 0.79
R9000:Akap9 UTSW 5 4055650 missense probably benign
R9049:Akap9 UTSW 5 4064597 missense
R9074:Akap9 UTSW 5 4077959 missense probably benign 0.40
R9124:Akap9 UTSW 5 4061284 missense probably damaging 0.99
R9129:Akap9 UTSW 5 4069089 missense probably benign 0.00
R9371:Akap9 UTSW 5 3961852 missense possibly damaging 0.83
R9424:Akap9 UTSW 5 3962223 nonsense probably null
R9424:Akap9 UTSW 5 3962224 nonsense probably null
R9509:Akap9 UTSW 5 4046349 missense probably benign
R9515:Akap9 UTSW 5 4055709 missense probably damaging 1.00
R9567:Akap9 UTSW 5 4077311 missense possibly damaging 0.89
R9587:Akap9 UTSW 5 4069149 missense probably damaging 1.00
R9619:Akap9 UTSW 5 4044833 missense probably damaging 1.00
R9635:Akap9 UTSW 5 4050545 missense probably benign 0.20
R9680:Akap9 UTSW 5 3961587 missense probably benign 0.03
R9691:Akap9 UTSW 5 3960491 missense probably damaging 1.00
R9726:Akap9 UTSW 5 4003757 missense probably benign 0.39
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 3962251 missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4046189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGGCCAGTTCCTTCC -3'
(R):5'- TCCTGGCACCTCAATGACATG -3'

Sequencing Primer
(F):5'- GCAGAAGCTAAGCTGTTACTTTC -3'
(R):5'- TGGCACCTCAATGACATGAATTAAC -3'
Posted On 2015-11-11