Incidental Mutation 'R4749:Akap9'
ID 357376
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene Name A kinase anchor protein 9
Synonyms mei2-5, repro12, AKAP450, G1-448-15, 5730481H23Rik
MMRRC Submission 041969-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.436) question?
Stock # R4749 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 3977410-4130204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4018737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1106 (D1106G)
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044492
AA Change: D1106G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: D1106G

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123119
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,204,153 (GRCm39) D79E probably benign Het
Adgra2 A G 8: 27,604,225 (GRCm39) K472E probably damaging Het
Arhgap35 T C 7: 16,232,551 (GRCm39) E1367G possibly damaging Het
Arsi A T 18: 61,050,533 (GRCm39) Y472F probably benign Het
Asxl3 A G 18: 22,649,826 (GRCm39) D605G probably damaging Het
Atp6v1e2 C T 17: 87,252,135 (GRCm39) D88N probably benign Het
BC061237 T A 14: 44,743,469 (GRCm39) V169E probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
C9 G A 15: 6,519,311 (GRCm39) V383I probably benign Het
Ccdc88a A G 11: 29,432,720 (GRCm39) K222R probably benign Het
Ccna2 T C 3: 36,620,391 (GRCm39) S421G probably benign Het
Cflar T G 1: 58,779,431 (GRCm39) V229G possibly damaging Het
Clcn1 A G 6: 42,267,131 (GRCm39) probably null Het
Col14a1 T A 15: 55,315,732 (GRCm39) F1342L unknown Het
Colq C T 14: 31,251,472 (GRCm39) R313H possibly damaging Het
Coro6 A G 11: 77,359,974 (GRCm39) E345G probably damaging Het
Cracd T C 5: 77,006,681 (GRCm39) V1014A unknown Het
Cyb561 A G 11: 105,826,708 (GRCm39) F182L probably benign Het
Dap3 A G 3: 88,833,617 (GRCm39) S317P probably benign Het
Dnah9 G A 11: 65,724,941 (GRCm39) A4404V probably damaging Het
Dsg4 A G 18: 20,579,888 (GRCm39) E31G possibly damaging Het
Dsn1 G A 2: 156,843,660 (GRCm39) L147F probably damaging Het
Dysf T C 6: 84,043,990 (GRCm39) V277A probably damaging Het
Eprs1 T A 1: 185,128,327 (GRCm39) I569K probably damaging Het
Erg T C 16: 95,162,029 (GRCm39) N342S probably damaging Het
Fam114a1 G A 5: 65,166,409 (GRCm39) D247N probably damaging Het
Fat2 A G 11: 55,202,294 (GRCm39) V260A probably benign Het
Foxn4 T C 5: 114,393,628 (GRCm39) D497G probably damaging Het
Fsip2 A G 2: 82,819,629 (GRCm39) I5121V probably benign Het
Gcn1 T A 5: 115,752,461 (GRCm39) D2155E probably benign Het
Glra1 C A 11: 55,427,210 (GRCm39) D42Y probably damaging Het
Gpr171 A G 3: 59,004,887 (GRCm39) V296A probably benign Het
Grid1 T A 14: 35,302,644 (GRCm39) S970T possibly damaging Het
Hcn3 A T 3: 89,057,370 (GRCm39) probably null Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Hsd3b3 G A 3: 98,649,931 (GRCm39) P131S probably damaging Het
Hsp90b1 A G 10: 86,537,672 (GRCm39) V211A probably damaging Het
Htr2c A G X: 145,976,793 (GRCm39) T163A probably benign Het
Ifi208 T A 1: 173,523,180 (GRCm39) D483E possibly damaging Het
Kbtbd6 T A 14: 79,690,727 (GRCm39) V474E possibly damaging Het
Kif21b T A 1: 136,072,487 (GRCm39) Y64* probably null Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Map3k10 T C 7: 27,357,786 (GRCm39) D664G possibly damaging Het
Map3k5 C A 10: 20,007,798 (GRCm39) S1201Y probably benign Het
Mcm2 T C 6: 88,868,973 (GRCm39) E293G possibly damaging Het
Med21 T A 6: 146,551,599 (GRCm39) probably null Het
Mettl18 T C 1: 163,824,354 (GRCm39) V225A probably benign Het
Mmp10 A T 9: 7,508,169 (GRCm39) I432F probably damaging Het
Muc5b T G 7: 141,415,185 (GRCm39) Y2710* probably null Het
Neurl4 A T 11: 69,801,894 (GRCm39) I1282F probably benign Het
Nipbl A T 15: 8,395,313 (GRCm39) H191Q possibly damaging Het
Nktr A G 9: 121,570,759 (GRCm39) D167G probably damaging Het
Nrap A G 19: 56,368,669 (GRCm39) I249T probably damaging Het
Nsfl1c A G 2: 151,351,526 (GRCm39) T297A probably benign Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Or1e1 G A 11: 73,245,322 (GRCm39) V248M probably damaging Het
Or4a39 C T 2: 89,236,599 (GRCm39) V275I probably benign Het
Or4k6 A G 14: 50,476,190 (GRCm39) S51P probably damaging Het
Or5b24 C T 19: 12,912,581 (GRCm39) H160Y probably benign Het
Or5d36 T A 2: 87,900,956 (GRCm39) I257L probably benign Het
Pcnx2 T C 8: 126,614,327 (GRCm39) S375G probably damaging Het
Pgap6 T C 17: 26,335,757 (GRCm39) F48S probably damaging Het
Phf2 A T 13: 48,975,185 (GRCm39) probably null Het
Piezo1 A T 8: 123,213,678 (GRCm39) M1739K possibly damaging Het
Piezo1 G T 8: 123,224,945 (GRCm39) Q654K probably damaging Het
Pml C T 9: 58,141,935 (GRCm39) R299H probably damaging Het
Ppp3cb A T 14: 20,574,130 (GRCm39) M236K probably damaging Het
Prkch T A 12: 73,739,734 (GRCm39) C203S probably damaging Het
Prob1 C T 18: 35,785,869 (GRCm39) R795H possibly damaging Het
Prr22 G C 17: 57,078,274 (GRCm39) E142D possibly damaging Het
Prss56 C A 1: 87,113,305 (GRCm39) A211E possibly damaging Het
Qser1 A C 2: 104,617,649 (GRCm39) S1054R probably benign Het
Rhbdl2 T C 4: 123,720,694 (GRCm39) probably null Het
Rhot2 C A 17: 26,063,248 (GRCm39) G19V probably damaging Het
Rp1l1 C T 14: 64,267,249 (GRCm39) T945M probably damaging Het
Ryr3 T C 2: 112,794,750 (GRCm39) T121A possibly damaging Het
Sdad1 C T 5: 92,452,836 (GRCm39) R134Q possibly damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sharpin T A 15: 76,231,767 (GRCm39) D314V probably damaging Het
Slc14a2 A T 18: 78,198,796 (GRCm39) L778Q probably damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc4a11 C A 2: 130,532,787 (GRCm39) R222L probably damaging Het
Slc7a10 C T 7: 34,900,187 (GRCm39) P502S probably damaging Het
Sort1 T G 3: 108,263,639 (GRCm39) Y812* probably null Het
Spata31d1b G A 13: 59,866,172 (GRCm39) V1107M probably damaging Het
Tcp10b G A 17: 13,289,832 (GRCm39) probably null Het
Tnc T C 4: 63,913,876 (GRCm39) D1312G possibly damaging Het
Tomm40l G A 1: 171,047,131 (GRCm39) R296* probably null Het
Topors A T 4: 40,261,015 (GRCm39) S756R unknown Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Ube2o T C 11: 116,432,734 (GRCm39) D744G probably benign Het
Vmn1r224 A G 17: 20,640,013 (GRCm39) I197V probably benign Het
Zc3h18 A T 8: 123,110,382 (GRCm39) D77V probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4,096,639 (GRCm39) missense probably damaging 0.97
IGL00642:Akap9 APN 5 4,010,842 (GRCm39) missense probably damaging 0.99
IGL00786:Akap9 APN 5 4,120,522 (GRCm39) missense probably damaging 1.00
IGL00788:Akap9 APN 5 4,110,480 (GRCm39) missense probably damaging 1.00
IGL00969:Akap9 APN 5 4,051,550 (GRCm39) missense probably benign
IGL01014:Akap9 APN 5 4,018,683 (GRCm39) missense probably benign 0.41
IGL01302:Akap9 APN 5 4,020,711 (GRCm39) missense probably benign 0.27
IGL01610:Akap9 APN 5 4,082,839 (GRCm39) missense possibly damaging 0.95
IGL01620:Akap9 APN 5 4,010,218 (GRCm39) missense probably benign 0.11
IGL01862:Akap9 APN 5 4,115,856 (GRCm39) missense probably damaging 0.99
IGL01862:Akap9 APN 5 4,001,705 (GRCm39) missense probably damaging 0.99
IGL02151:Akap9 APN 5 4,082,728 (GRCm39) nonsense probably null
IGL02635:Akap9 APN 5 4,120,500 (GRCm39) missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4,119,130 (GRCm39) missense possibly damaging 0.88
IGL02967:Akap9 APN 5 4,026,164 (GRCm39) missense probably benign 0.07
IGL03064:Akap9 APN 5 4,018,755 (GRCm39) missense probably damaging 1.00
IGL03289:Akap9 APN 5 4,127,261 (GRCm39) missense probably damaging 1.00
Andy UTSW 5 4,011,764 (GRCm39) nonsense probably null
blimey UTSW 5 4,120,397 (GRCm39) nonsense probably null
hoarder UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
marinarum UTSW 5 4,063,875 (GRCm39) nonsense probably null
miser UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
naviculus UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
thrifty UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
wee_one UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
FR4449:Akap9 UTSW 5 4,031,214 (GRCm39) unclassified probably benign
PIT1430001:Akap9 UTSW 5 4,079,849 (GRCm39) missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4,096,221 (GRCm39) missense probably benign 0.24
R0088:Akap9 UTSW 5 4,011,946 (GRCm39) missense probably benign 0.22
R0309:Akap9 UTSW 5 4,119,038 (GRCm39) missense probably benign 0.01
R0387:Akap9 UTSW 5 4,001,678 (GRCm39) splice site probably benign
R0440:Akap9 UTSW 5 4,114,569 (GRCm39) missense probably damaging 0.99
R0441:Akap9 UTSW 5 4,011,714 (GRCm39) missense probably benign 0.15
R0491:Akap9 UTSW 5 4,022,851 (GRCm39) unclassified probably benign
R0501:Akap9 UTSW 5 4,020,685 (GRCm39) missense probably damaging 1.00
R0507:Akap9 UTSW 5 4,119,043 (GRCm39) missense probably benign 0.41
R0544:Akap9 UTSW 5 4,119,185 (GRCm39) missense probably benign 0.22
R0581:Akap9 UTSW 5 4,100,620 (GRCm39) missense probably benign 0.03
R0611:Akap9 UTSW 5 4,004,870 (GRCm39) missense probably benign 0.00
R0620:Akap9 UTSW 5 4,114,136 (GRCm39) missense probably damaging 0.98
R0639:Akap9 UTSW 5 4,110,318 (GRCm39) missense probably damaging 1.00
R0932:Akap9 UTSW 5 4,096,492 (GRCm39) missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4,114,742 (GRCm39) splice site probably null
R1101:Akap9 UTSW 5 4,096,205 (GRCm39) missense probably benign 0.00
R1159:Akap9 UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
R1170:Akap9 UTSW 5 4,105,671 (GRCm39) missense probably benign
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1453:Akap9 UTSW 5 4,025,614 (GRCm39) splice site probably null
R1551:Akap9 UTSW 5 4,119,174 (GRCm39) missense probably benign 0.02
R1608:Akap9 UTSW 5 4,011,783 (GRCm39) missense probably damaging 1.00
R1652:Akap9 UTSW 5 4,127,210 (GRCm39) missense probably damaging 1.00
R1659:Akap9 UTSW 5 4,114,633 (GRCm39) missense probably damaging 1.00
R1713:Akap9 UTSW 5 4,089,345 (GRCm39) critical splice donor site probably null
R1719:Akap9 UTSW 5 4,007,645 (GRCm39) nonsense probably null
R1720:Akap9 UTSW 5 4,022,791 (GRCm39) missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4,051,667 (GRCm39) missense probably benign 0.41
R1872:Akap9 UTSW 5 4,051,406 (GRCm39) missense probably damaging 1.00
R1876:Akap9 UTSW 5 4,011,809 (GRCm39) missense probably benign 0.28
R1881:Akap9 UTSW 5 4,100,173 (GRCm39) missense probably benign
R1950:Akap9 UTSW 5 4,010,677 (GRCm39) missense probably damaging 1.00
R1980:Akap9 UTSW 5 4,022,771 (GRCm39) missense probably damaging 0.99
R1993:Akap9 UTSW 5 4,088,520 (GRCm39) splice site probably null
R2008:Akap9 UTSW 5 4,010,131 (GRCm39) missense possibly damaging 0.47
R2020:Akap9 UTSW 5 4,011,967 (GRCm39) missense probably damaging 1.00
R2051:Akap9 UTSW 5 4,025,685 (GRCm39) nonsense probably null
R2061:Akap9 UTSW 5 4,011,010 (GRCm39) missense probably damaging 1.00
R2109:Akap9 UTSW 5 4,094,847 (GRCm39) missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4,114,509 (GRCm39) missense probably damaging 1.00
R2225:Akap9 UTSW 5 4,127,271 (GRCm39) missense probably damaging 0.96
R2232:Akap9 UTSW 5 4,096,603 (GRCm39) missense probably damaging 1.00
R2424:Akap9 UTSW 5 4,115,279 (GRCm39) missense probably damaging 0.97
R2483:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R2879:Akap9 UTSW 5 4,026,353 (GRCm39) intron probably benign
R3622:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3623:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3624:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4,120,351 (GRCm39) missense probably damaging 1.00
R3806:Akap9 UTSW 5 4,004,410 (GRCm39) missense probably benign 0.00
R3919:Akap9 UTSW 5 4,011,764 (GRCm39) nonsense probably null
R4023:Akap9 UTSW 5 4,042,077 (GRCm39) missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4,093,996 (GRCm39) missense probably damaging 0.99
R4434:Akap9 UTSW 5 4,082,708 (GRCm39) missense probably damaging 0.99
R4529:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4530:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4532:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4533:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4585:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4586:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4655:Akap9 UTSW 5 4,096,403 (GRCm39) missense probably benign 0.14
R4676:Akap9 UTSW 5 4,114,515 (GRCm39) nonsense probably null
R4676:Akap9 UTSW 5 4,082,774 (GRCm39) missense probably damaging 1.00
R4724:Akap9 UTSW 5 4,105,339 (GRCm39) missense probably benign
R4731:Akap9 UTSW 5 4,012,266 (GRCm39) missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4733:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4743:Akap9 UTSW 5 4,011,013 (GRCm39) missense probably damaging 1.00
R4756:Akap9 UTSW 5 4,051,418 (GRCm39) missense probably damaging 0.99
R4757:Akap9 UTSW 5 4,058,382 (GRCm39) missense probably damaging 1.00
R4860:Akap9 UTSW 5 4,084,916 (GRCm39) intron probably benign
R4937:Akap9 UTSW 5 4,100,145 (GRCm39) splice site probably null
R4960:Akap9 UTSW 5 4,007,664 (GRCm39) missense probably benign 0.15
R4974:Akap9 UTSW 5 4,011,466 (GRCm39) missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4,051,748 (GRCm39) missense probably damaging 0.96
R5160:Akap9 UTSW 5 4,080,007 (GRCm39) missense probably damaging 1.00
R5200:Akap9 UTSW 5 4,010,734 (GRCm39) missense probably benign 0.00
R5245:Akap9 UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
R5293:Akap9 UTSW 5 3,998,687 (GRCm39) missense probably damaging 0.99
R5408:Akap9 UTSW 5 4,108,458 (GRCm39) missense possibly damaging 0.84
R5507:Akap9 UTSW 5 4,018,683 (GRCm39) missense probably benign 0.41
R5517:Akap9 UTSW 5 4,051,665 (GRCm39) missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4,114,714 (GRCm39) missense possibly damaging 0.93
R5619:Akap9 UTSW 5 4,004,760 (GRCm39) intron probably benign
R5645:Akap9 UTSW 5 4,100,590 (GRCm39) missense probably benign 0.09
R5669:Akap9 UTSW 5 4,100,540 (GRCm39) nonsense probably null
R5686:Akap9 UTSW 5 4,021,926 (GRCm39) missense probably benign 0.00
R5697:Akap9 UTSW 5 4,010,170 (GRCm39) missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
R5875:Akap9 UTSW 5 4,127,285 (GRCm39) missense probably benign 0.01
R5897:Akap9 UTSW 5 4,127,904 (GRCm39) missense probably benign 0.23
R5999:Akap9 UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
R6025:Akap9 UTSW 5 4,082,801 (GRCm39) missense probably damaging 1.00
R6078:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6138:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6225:Akap9 UTSW 5 4,012,105 (GRCm39) missense probably damaging 1.00
R6243:Akap9 UTSW 5 4,115,000 (GRCm39) splice site probably null
R6326:Akap9 UTSW 5 4,012,061 (GRCm39) missense probably damaging 1.00
R6564:Akap9 UTSW 5 4,078,491 (GRCm39) missense probably damaging 0.98
R6617:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6625:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6632:Akap9 UTSW 5 4,063,842 (GRCm39) splice site probably null
R6677:Akap9 UTSW 5 4,079,869 (GRCm39) missense probably benign 0.21
R6717:Akap9 UTSW 5 4,114,086 (GRCm39) missense probably damaging 1.00
R6893:Akap9 UTSW 5 4,011,709 (GRCm39) missense probably benign 0.32
R6915:Akap9 UTSW 5 4,010,551 (GRCm39) missense probably benign 0.03
R6938:Akap9 UTSW 5 4,096,628 (GRCm39) missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4,115,866 (GRCm39) missense possibly damaging 0.65
R7032:Akap9 UTSW 5 4,004,896 (GRCm39) missense probably benign
R7164:Akap9 UTSW 5 4,110,364 (GRCm39) missense probably damaging 0.96
R7170:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7192:Akap9 UTSW 5 4,055,723 (GRCm39) splice site probably null
R7284:Akap9 UTSW 5 4,006,246 (GRCm39) missense probably damaging 1.00
R7299:Akap9 UTSW 5 4,082,696 (GRCm39) missense probably damaging 1.00
R7313:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7326:Akap9 UTSW 5 4,095,930 (GRCm39) missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4,096,364 (GRCm39) missense probably damaging 0.99
R7455:Akap9 UTSW 5 4,022,792 (GRCm39) missense probably benign 0.03
R7482:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7489:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7525:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7528:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7576:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7577:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7578:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7610:Akap9 UTSW 5 4,007,677 (GRCm39) missense possibly damaging 0.95
R7658:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7754:Akap9 UTSW 5 4,096,736 (GRCm39) missense probably benign 0.03
R7818:Akap9 UTSW 5 4,063,875 (GRCm39) nonsense probably null
R7979:Akap9 UTSW 5 4,100,381 (GRCm39) missense probably benign
R7991:Akap9 UTSW 5 4,114,949 (GRCm39) splice site probably null
R8036:Akap9 UTSW 5 4,120,397 (GRCm39) nonsense probably null
R8054:Akap9 UTSW 5 4,088,707 (GRCm39) critical splice donor site probably null
R8116:Akap9 UTSW 5 4,111,183 (GRCm39) missense probably benign 0.04
R8150:Akap9 UTSW 5 4,011,982 (GRCm39) missense probably damaging 1.00
R8234:Akap9 UTSW 5 4,094,845 (GRCm39) missense probably benign 0.18
R8348:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8365:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8366:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8448:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8466:Akap9 UTSW 5 4,088,659 (GRCm39) missense probably damaging 1.00
R8772:Akap9 UTSW 5 4,096,255 (GRCm39) missense probably damaging 1.00
R8881:Akap9 UTSW 5 4,011,279 (GRCm39) missense
R8937:Akap9 UTSW 5 4,094,048 (GRCm39) missense possibly damaging 0.78
R8956:Akap9 UTSW 5 3,998,805 (GRCm39) missense possibly damaging 0.79
R9000:Akap9 UTSW 5 4,105,650 (GRCm39) missense probably benign
R9049:Akap9 UTSW 5 4,114,597 (GRCm39) missense
R9074:Akap9 UTSW 5 4,127,959 (GRCm39) missense probably benign 0.40
R9124:Akap9 UTSW 5 4,111,284 (GRCm39) missense probably damaging 0.99
R9129:Akap9 UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
R9371:Akap9 UTSW 5 4,011,852 (GRCm39) missense possibly damaging 0.83
R9424:Akap9 UTSW 5 4,012,224 (GRCm39) nonsense probably null
R9424:Akap9 UTSW 5 4,012,223 (GRCm39) nonsense probably null
R9509:Akap9 UTSW 5 4,096,349 (GRCm39) missense probably benign
R9515:Akap9 UTSW 5 4,105,709 (GRCm39) missense probably damaging 1.00
R9567:Akap9 UTSW 5 4,127,311 (GRCm39) missense possibly damaging 0.89
R9587:Akap9 UTSW 5 4,119,149 (GRCm39) missense probably damaging 1.00
R9619:Akap9 UTSW 5 4,094,833 (GRCm39) missense probably damaging 1.00
R9635:Akap9 UTSW 5 4,100,545 (GRCm39) missense probably benign 0.20
R9680:Akap9 UTSW 5 4,011,587 (GRCm39) missense probably benign 0.03
R9691:Akap9 UTSW 5 4,010,491 (GRCm39) missense probably damaging 1.00
R9726:Akap9 UTSW 5 4,053,757 (GRCm39) missense probably benign 0.39
U15987:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
X0026:Akap9 UTSW 5 4,064,039 (GRCm39) missense probably damaging 1.00
X0057:Akap9 UTSW 5 4,025,598 (GRCm39) critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 4,012,251 (GRCm39) missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4,096,189 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGGCCAGTTCCTTCC -3'
(R):5'- TCCTGGCACCTCAATGACATG -3'

Sequencing Primer
(F):5'- GCAGAAGCTAAGCTGTTACTTTC -3'
(R):5'- TGGCACCTCAATGACATGAATTAAC -3'
Posted On 2015-11-11