Incidental Mutation 'R4749:Sdad1'
ID 357379
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene Name SDA1 domain containing 1
Synonyms
MMRRC Submission 041969-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R4749 (G1)
Quality Score 215
Status Not validated
Chromosome 5
Chromosomal Location 92431869-92457883 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 92452836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 134 (R134Q)
Ref Sequence ENSEMBL: ENSMUSP00000144446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143] [ENSMUST00000202870]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031364
AA Change: R134Q

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: R134Q

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201084
Predicted Effect possibly damaging
Transcript: ENSMUST00000201143
AA Change: R134Q

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: R134Q

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202680
Predicted Effect probably benign
Transcript: ENSMUST00000202870
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,204,153 (GRCm39) D79E probably benign Het
Adgra2 A G 8: 27,604,225 (GRCm39) K472E probably damaging Het
Akap9 A G 5: 4,018,737 (GRCm39) D1106G probably benign Het
Arhgap35 T C 7: 16,232,551 (GRCm39) E1367G possibly damaging Het
Arsi A T 18: 61,050,533 (GRCm39) Y472F probably benign Het
Asxl3 A G 18: 22,649,826 (GRCm39) D605G probably damaging Het
Atp6v1e2 C T 17: 87,252,135 (GRCm39) D88N probably benign Het
BC061237 T A 14: 44,743,469 (GRCm39) V169E probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
C9 G A 15: 6,519,311 (GRCm39) V383I probably benign Het
Ccdc88a A G 11: 29,432,720 (GRCm39) K222R probably benign Het
Ccna2 T C 3: 36,620,391 (GRCm39) S421G probably benign Het
Cflar T G 1: 58,779,431 (GRCm39) V229G possibly damaging Het
Clcn1 A G 6: 42,267,131 (GRCm39) probably null Het
Col14a1 T A 15: 55,315,732 (GRCm39) F1342L unknown Het
Colq C T 14: 31,251,472 (GRCm39) R313H possibly damaging Het
Coro6 A G 11: 77,359,974 (GRCm39) E345G probably damaging Het
Cracd T C 5: 77,006,681 (GRCm39) V1014A unknown Het
Cyb561 A G 11: 105,826,708 (GRCm39) F182L probably benign Het
Dap3 A G 3: 88,833,617 (GRCm39) S317P probably benign Het
Dnah9 G A 11: 65,724,941 (GRCm39) A4404V probably damaging Het
Dsg4 A G 18: 20,579,888 (GRCm39) E31G possibly damaging Het
Dsn1 G A 2: 156,843,660 (GRCm39) L147F probably damaging Het
Dysf T C 6: 84,043,990 (GRCm39) V277A probably damaging Het
Eprs1 T A 1: 185,128,327 (GRCm39) I569K probably damaging Het
Erg T C 16: 95,162,029 (GRCm39) N342S probably damaging Het
Fam114a1 G A 5: 65,166,409 (GRCm39) D247N probably damaging Het
Fat2 A G 11: 55,202,294 (GRCm39) V260A probably benign Het
Foxn4 T C 5: 114,393,628 (GRCm39) D497G probably damaging Het
Fsip2 A G 2: 82,819,629 (GRCm39) I5121V probably benign Het
Gcn1 T A 5: 115,752,461 (GRCm39) D2155E probably benign Het
Glra1 C A 11: 55,427,210 (GRCm39) D42Y probably damaging Het
Gpr171 A G 3: 59,004,887 (GRCm39) V296A probably benign Het
Grid1 T A 14: 35,302,644 (GRCm39) S970T possibly damaging Het
Hcn3 A T 3: 89,057,370 (GRCm39) probably null Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Hsd3b3 G A 3: 98,649,931 (GRCm39) P131S probably damaging Het
Hsp90b1 A G 10: 86,537,672 (GRCm39) V211A probably damaging Het
Htr2c A G X: 145,976,793 (GRCm39) T163A probably benign Het
Ifi208 T A 1: 173,523,180 (GRCm39) D483E possibly damaging Het
Kbtbd6 T A 14: 79,690,727 (GRCm39) V474E possibly damaging Het
Kif21b T A 1: 136,072,487 (GRCm39) Y64* probably null Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Map3k10 T C 7: 27,357,786 (GRCm39) D664G possibly damaging Het
Map3k5 C A 10: 20,007,798 (GRCm39) S1201Y probably benign Het
Mcm2 T C 6: 88,868,973 (GRCm39) E293G possibly damaging Het
Med21 T A 6: 146,551,599 (GRCm39) probably null Het
Mettl18 T C 1: 163,824,354 (GRCm39) V225A probably benign Het
Mmp10 A T 9: 7,508,169 (GRCm39) I432F probably damaging Het
Muc5b T G 7: 141,415,185 (GRCm39) Y2710* probably null Het
Neurl4 A T 11: 69,801,894 (GRCm39) I1282F probably benign Het
Nipbl A T 15: 8,395,313 (GRCm39) H191Q possibly damaging Het
Nktr A G 9: 121,570,759 (GRCm39) D167G probably damaging Het
Nrap A G 19: 56,368,669 (GRCm39) I249T probably damaging Het
Nsfl1c A G 2: 151,351,526 (GRCm39) T297A probably benign Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Or1e1 G A 11: 73,245,322 (GRCm39) V248M probably damaging Het
Or4a39 C T 2: 89,236,599 (GRCm39) V275I probably benign Het
Or4k6 A G 14: 50,476,190 (GRCm39) S51P probably damaging Het
Or5b24 C T 19: 12,912,581 (GRCm39) H160Y probably benign Het
Or5d36 T A 2: 87,900,956 (GRCm39) I257L probably benign Het
Pcnx2 T C 8: 126,614,327 (GRCm39) S375G probably damaging Het
Pgap6 T C 17: 26,335,757 (GRCm39) F48S probably damaging Het
Phf2 A T 13: 48,975,185 (GRCm39) probably null Het
Piezo1 A T 8: 123,213,678 (GRCm39) M1739K possibly damaging Het
Piezo1 G T 8: 123,224,945 (GRCm39) Q654K probably damaging Het
Pml C T 9: 58,141,935 (GRCm39) R299H probably damaging Het
Ppp3cb A T 14: 20,574,130 (GRCm39) M236K probably damaging Het
Prkch T A 12: 73,739,734 (GRCm39) C203S probably damaging Het
Prob1 C T 18: 35,785,869 (GRCm39) R795H possibly damaging Het
Prr22 G C 17: 57,078,274 (GRCm39) E142D possibly damaging Het
Prss56 C A 1: 87,113,305 (GRCm39) A211E possibly damaging Het
Qser1 A C 2: 104,617,649 (GRCm39) S1054R probably benign Het
Rhbdl2 T C 4: 123,720,694 (GRCm39) probably null Het
Rhot2 C A 17: 26,063,248 (GRCm39) G19V probably damaging Het
Rp1l1 C T 14: 64,267,249 (GRCm39) T945M probably damaging Het
Ryr3 T C 2: 112,794,750 (GRCm39) T121A possibly damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sharpin T A 15: 76,231,767 (GRCm39) D314V probably damaging Het
Slc14a2 A T 18: 78,198,796 (GRCm39) L778Q probably damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc4a11 C A 2: 130,532,787 (GRCm39) R222L probably damaging Het
Slc7a10 C T 7: 34,900,187 (GRCm39) P502S probably damaging Het
Sort1 T G 3: 108,263,639 (GRCm39) Y812* probably null Het
Spata31d1b G A 13: 59,866,172 (GRCm39) V1107M probably damaging Het
Tcp10b G A 17: 13,289,832 (GRCm39) probably null Het
Tnc T C 4: 63,913,876 (GRCm39) D1312G possibly damaging Het
Tomm40l G A 1: 171,047,131 (GRCm39) R296* probably null Het
Topors A T 4: 40,261,015 (GRCm39) S756R unknown Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Ube2o T C 11: 116,432,734 (GRCm39) D744G probably benign Het
Vmn1r224 A G 17: 20,640,013 (GRCm39) I197V probably benign Het
Zc3h18 A T 8: 123,110,382 (GRCm39) D77V probably damaging Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92,451,632 (GRCm39) splice site probably null
IGL01355:Sdad1 APN 5 92,450,538 (GRCm39) missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92,445,019 (GRCm39) missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92,439,621 (GRCm39) missense probably benign 0.03
IGL02503:Sdad1 APN 5 92,449,661 (GRCm39) unclassified probably benign
IGL02739:Sdad1 APN 5 92,437,931 (GRCm39) missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92,439,777 (GRCm39) missense probably damaging 1.00
R0583:Sdad1 UTSW 5 92,452,923 (GRCm39) missense probably damaging 0.97
R1169:Sdad1 UTSW 5 92,446,092 (GRCm39) missense probably benign 0.32
R1496:Sdad1 UTSW 5 92,457,682 (GRCm39) missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92,453,155 (GRCm39) nonsense probably null
R1848:Sdad1 UTSW 5 92,440,510 (GRCm39) critical splice donor site probably null
R2419:Sdad1 UTSW 5 92,453,677 (GRCm39) missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92,447,958 (GRCm39) missense probably benign 0.00
R2509:Sdad1 UTSW 5 92,453,684 (GRCm39) missense probably benign 0.12
R4043:Sdad1 UTSW 5 92,450,553 (GRCm39) missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92,446,116 (GRCm39) missense probably benign 0.01
R4477:Sdad1 UTSW 5 92,445,019 (GRCm39) missense probably damaging 0.98
R4478:Sdad1 UTSW 5 92,445,019 (GRCm39) missense probably damaging 0.98
R4734:Sdad1 UTSW 5 92,452,836 (GRCm39) missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92,451,793 (GRCm39) missense probably benign 0.00
R5288:Sdad1 UTSW 5 92,434,684 (GRCm39) makesense probably null
R6331:Sdad1 UTSW 5 92,451,789 (GRCm39) missense probably damaging 1.00
R7038:Sdad1 UTSW 5 92,446,049 (GRCm39) critical splice donor site probably null
R7099:Sdad1 UTSW 5 92,441,832 (GRCm39) missense possibly damaging 0.89
R7420:Sdad1 UTSW 5 92,453,596 (GRCm39) missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92,447,980 (GRCm39) missense probably benign 0.10
R7714:Sdad1 UTSW 5 92,450,538 (GRCm39) missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92,447,948 (GRCm39) missense probably benign 0.01
R8198:Sdad1 UTSW 5 92,439,811 (GRCm39) missense probably damaging 0.96
R8347:Sdad1 UTSW 5 92,446,088 (GRCm39) missense probably benign 0.00
R8693:Sdad1 UTSW 5 92,452,857 (GRCm39) missense probably benign 0.09
R8696:Sdad1 UTSW 5 92,437,645 (GRCm39) missense probably damaging 1.00
R8746:Sdad1 UTSW 5 92,437,784 (GRCm39) missense probably benign
R9004:Sdad1 UTSW 5 92,439,820 (GRCm39) missense probably benign 0.00
R9166:Sdad1 UTSW 5 92,446,080 (GRCm39) nonsense probably null
R9732:Sdad1 UTSW 5 92,438,942 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGATGCAGAGTTTTCTTACC -3'
(R):5'- AGATCTCCGCATGGTAGGAAG -3'

Sequencing Primer
(F):5'- GATGCAGAGTTTTCTTACCAATCTC -3'
(R):5'- CATGGTAGGAAGGCCGCAC -3'
Posted On 2015-11-11