Mutagenetix > Incidental Mutation

Incidental Mutation 'R4749:C1galt1'

357382

Institutional Source

Beutler Lab

Gene Symbol

C1galt1

Ensembl Gene

ENSMUSG00000042460

Gene Name

core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1

Synonyms

T-synthase, core 1 beta3-Gal-T, 2210410E06Rik

MMRRC Submission

041969-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7844842-7875687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7866379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 75 (E75G)

Ref Sequence

ENSEMBL: ENSMUSP00000047931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040159]

AlphaFold

Q9JJ06

Predicted Effect

probably benign
Transcript: ENSMUST00000040159
AA Change: E75G

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000047931
Gene: ENSMUSG00000042460
AA Change: E75G

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Fringe	83	283	3e-18	PFAM
Pfam:Galactosyl_T	108	258	6.2e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene generates the common core 1 O-glycan structure, Gal-beta-1-3GalNAc-R, by the transfer of Gal from UDP-Gal to GalNAc-alpha-1-R. Core 1 is a precursor for many extended mucin-type O-glycans on cell surface and secreted glycoproteins. Studies in mice suggest that this gene plays a key role in thrombopoiesis and kidney homeostasis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Embryos homozygous for a null allele show impaired angiogenesis, chaotic microvascular networks in brain, and fatal hemorrhage by E14. Eggs homozygous for another null allele show a slightly thinner zona pellucida. Mice homozygous for an ENU-induced allele develop thrombocytopenia and renal disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	T	19: 57,215,721	D79E	probably benign	Het
Adgra2	A	G	8: 27,114,197	K472E	probably damaging	Het
Akap9	A	G	5: 3,968,737	D1106G	probably benign	Het
Arhgap35	T	C	7: 16,498,626	E1367G	possibly damaging	Het
Arsi	A	T	18: 60,917,461	Y472F	probably benign	Het
Asxl3	A	G	18: 22,516,769	D605G	probably damaging	Het
Atp6v1e2	C	T	17: 86,944,707	D88N	probably benign	Het
BC061237	T	A	14: 44,506,012	V169E	probably damaging	Het
C530008M17Rik	T	C	5: 76,858,834	V1014A	unknown	Het
C9	G	A	15: 6,489,830	V383I	probably benign	Het
Ccdc88a	A	G	11: 29,482,720	K222R	probably benign	Het
Ccna2	T	C	3: 36,566,242	S421G	probably benign	Het
Cflar	T	G	1: 58,740,272	V229G	possibly damaging	Het
Clcn1	A	G	6: 42,290,197		probably null	Het
Col14a1	T	A	15: 55,452,336	F1342L	unknown	Het
Colq	C	T	14: 31,529,515	R313H	possibly damaging	Het
Coro6	A	G	11: 77,469,148	E345G	probably damaging	Het
Cyb561	A	G	11: 105,935,882	F182L	probably benign	Het
Dap3	A	G	3: 88,926,310	S317P	probably benign	Het
Dnah9	G	A	11: 65,834,115	A4404V	probably damaging	Het
Dsg4	A	G	18: 20,446,831	E31G	possibly damaging	Het
Dsn1	G	A	2: 157,001,740	L147F	probably damaging	Het
Dysf	T	C	6: 84,067,008	V277A	probably damaging	Het
Eprs	T	A	1: 185,396,130	I569K	probably damaging	Het
Erg	T	C	16: 95,361,170	N342S	probably damaging	Het
Fam114a1	G	A	5: 65,009,066	D247N	probably damaging	Het
Fat2	A	G	11: 55,311,468	V260A	probably benign	Het
Foxn4	T	C	5: 114,255,567	D497G	probably damaging	Het
Fsip2	A	G	2: 82,989,285	I5121V	probably benign	Het
Gcn1l1	T	A	5: 115,614,402	D2155E	probably benign	Het
Glra1	C	A	11: 55,536,384	D42Y	probably damaging	Het
Gpr171	A	G	3: 59,097,466	V296A	probably benign	Het
Grid1	T	A	14: 35,580,687	S970T	possibly damaging	Het
Hcn3	A	T	3: 89,150,063		probably null	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Hsd3b3	G	A	3: 98,742,615	P131S	probably damaging	Het
Hsp90b1	A	G	10: 86,701,808	V211A	probably damaging	Het
Htr2c	A	G	X: 147,193,797	T163A	probably benign	Het
Ifi208	T	A	1: 173,695,614	D483E	possibly damaging	Het
Kbtbd6	T	A	14: 79,453,287	V474E	possibly damaging	Het
Kif21b	T	A	1: 136,144,749	Y64*	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Map3k10	T	C	7: 27,658,361	D664G	possibly damaging	Het
Map3k5	C	A	10: 20,132,052	S1201Y	probably benign	Het
Mcm2	T	C	6: 88,891,991	E293G	possibly damaging	Het
Med21	T	A	6: 146,650,101		probably null	Het
Mettl18	T	C	1: 163,996,785	V225A	probably benign	Het
Mmp10	A	T	9: 7,508,168	I432F	probably damaging	Het
Muc5b	T	G	7: 141,861,448	Y2710*	probably null	Het
Neurl4	A	T	11: 69,911,068	I1282F	probably benign	Het
Nipbl	A	T	15: 8,365,829	H191Q	possibly damaging	Het
Nktr	A	G	9: 121,741,693	D167G	probably damaging	Het
Nrap	A	G	19: 56,380,237	I249T	probably damaging	Het
Nsfl1c	A	G	2: 151,509,606	T297A	probably benign	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr1449	C	T	19: 12,935,217	H160Y	probably benign	Het
Olfr20	G	A	11: 73,354,496	V248M	probably damaging	Het
Olfr731	A	G	14: 50,238,733	S51P	probably damaging	Het
Pcnx2	T	C	8: 125,887,588	S375G	probably damaging	Het
Phf2	A	T	13: 48,821,709		probably null	Het
Piezo1	A	T	8: 122,486,939	M1739K	possibly damaging	Het
Piezo1	G	T	8: 122,498,206	Q654K	probably damaging	Het
Pml	C	T	9: 58,234,652	R299H	probably damaging	Het
Ppp3cb	A	T	14: 20,524,062	M236K	probably damaging	Het
Prkch	T	A	12: 73,692,960	C203S	probably damaging	Het
Prob1	C	T	18: 35,652,816	R795H	possibly damaging	Het
Prr22	G	C	17: 56,771,274	E142D	possibly damaging	Het
Prss56	C	A	1: 87,185,583	A211E	possibly damaging	Het
Qser1	A	C	2: 104,787,304	S1054R	probably benign	Het
Rhbdl2	T	C	4: 123,826,901		probably null	Het
Rhot2	C	A	17: 25,844,274	G19V	probably damaging	Het
Rp1l1	C	T	14: 64,029,800	T945M	probably damaging	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Sdad1	C	T	5: 92,304,977	R134Q	possibly damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Sharpin	T	A	15: 76,347,567	D314V	probably damaging	Het
Slc14a2	A	T	18: 78,155,581	L778Q	probably damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc4a11	C	A	2: 130,690,867	R222L	probably damaging	Het
Slc7a10	C	T	7: 35,200,762	P502S	probably damaging	Het
Sort1	T	G	3: 108,356,323	Y812*	probably null	Het
Spata31d1b	G	A	13: 59,718,358	V1107M	probably damaging	Het
Tcp10b	G	A	17: 13,070,945		probably null	Het
Tmem8	T	C	17: 26,116,783	F48S	probably damaging	Het
Tnc	T	C	4: 63,995,639	D1312G	possibly damaging	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Topors	A	T	4: 40,261,015	S756R	unknown	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Ube2o	T	C	11: 116,541,908	D744G	probably benign	Het
Vmn1r224	A	G	17: 20,419,751	I197V	probably benign	Het
Zc3h18	A	T	8: 122,383,643	D77V	probably damaging	Het

Other mutations in C1galt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00696:C1galt1	APN	6	7866475	missense	probably damaging	0.98
PIT4378001:C1galt1	UTSW	6	7863944	missense	probably benign	0.01
R0086:C1galt1	UTSW	6	7867051	splice site	probably benign
R0540:C1galt1	UTSW	6	7871193	missense	probably benign	0.00
R0567:C1galt1	UTSW	6	7866874	missense	probably damaging	1.00
R0607:C1galt1	UTSW	6	7871193	missense	probably benign	0.00
R1519:C1galt1	UTSW	6	7866402	missense	probably damaging	0.99
R1712:C1galt1	UTSW	6	7871217	missense	probably benign
R2989:C1galt1	UTSW	6	7866622	missense	possibly damaging	0.50
R3035:C1galt1	UTSW	6	7866762	missense	probably benign	0.06
R4271:C1galt1	UTSW	6	7866607	missense	probably damaging	1.00
R5029:C1galt1	UTSW	6	7863931	missense	possibly damaging	0.95
R5393:C1galt1	UTSW	6	7864143	critical splice donor site	probably null
R5448:C1galt1	UTSW	6	7866658	missense	possibly damaging	0.95
R7055:C1galt1	UTSW	6	7866585	missense	probably damaging	1.00
R7319:C1galt1	UTSW	6	7871150	missense	probably damaging	1.00
R8887:C1galt1	UTSW	6	7866379	missense	probably benign	0.42
R9355:C1galt1	UTSW	6	7866474	missense	probably damaging	1.00
R9755:C1galt1	UTSW	6	7867019	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCACTTAGGAGGAGCTAGTG -3'
(R):5'- TGGTTTTCAATCCCACAGTAGG -3'

Sequencing Primer
(F):5'- AGGAGCTAGTGATGTTTCAGAGATC -3'
(R):5'- CCACAGTAGGGAAGTCTTGATTTTC -3'

Posted On

2015-11-11