Incidental Mutation 'R4749:Dysf'
ID357385
Institutional Source Beutler Lab
Gene Symbol Dysf
Ensembl Gene ENSMUSG00000033788
Gene Namedysferlin
Synonyms2310004N10Rik
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4749 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location84008590-84211060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84067008 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 277 (V277A)
Ref Sequence ENSEMBL: ENSMUSP00000145292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081904] [ENSMUST00000089595] [ENSMUST00000113818] [ENSMUST00000113821] [ENSMUST00000113823] [ENSMUST00000153860] [ENSMUST00000168387] [ENSMUST00000203695] [ENSMUST00000203803] [ENSMUST00000204354] [ENSMUST00000204591] [ENSMUST00000204987]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081904
AA Change: V277A

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080579
Gene: ENSMUSG00000033788
AA Change: V277A

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 4.84e-14 SMART
FerI 337 408 5.3e-39 SMART
C2 414 528 2.96e-9 SMART
FerA 714 779 6.3e-23 SMART
FerB 806 880 2.49e-44 SMART
DysFN 894 953 1.42e-22 SMART
DysFN 966 1022 2.65e-22 SMART
DysFC 1031 1069 1.33e-13 SMART
DysFC 1088 1121 1.1e-10 SMART
C2 1173 1281 2.63e-15 SMART
C2 1350 1457 7.13e0 SMART
C2 1599 1698 2.52e-12 SMART
C2 1832 1961 1.55e-3 SMART
Pfam:Ferlin_C 1991 2095 6.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089595
AA Change: V246A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087022
Gene: ENSMUSG00000033788
AA Change: V246A

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 1.12e-9 SMART
FerA 697 762 6.3e-23 SMART
FerB 789 863 2.49e-44 SMART
DysFN 877 936 1.42e-22 SMART
DysFN 949 1005 2.65e-22 SMART
DysFC 1014 1052 1.33e-13 SMART
DysFC 1071 1104 1.1e-10 SMART
C2 1156 1264 2.63e-15 SMART
C2 1333 1440 7.13e0 SMART
C2 1582 1681 2.52e-12 SMART
C2 1815 1944 1.55e-3 SMART
Pfam:Ferlin_C 1974 2078 3.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113818
AA Change: V246A

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109449
Gene: ENSMUSG00000033788
AA Change: V246A

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 2.96e-9 SMART
FerA 683 748 6.3e-23 SMART
FerB 775 849 2.49e-44 SMART
DysFN 863 922 1.42e-22 SMART
DysFN 935 991 2.65e-22 SMART
DysFC 1000 1038 1.33e-13 SMART
DysFC 1057 1090 1.1e-10 SMART
C2 1142 1250 2.63e-15 SMART
C2 1319 1426 7.13e0 SMART
C2 1568 1667 2.52e-12 SMART
C2 1801 1930 1.55e-3 SMART
transmembrane domain 2034 2056 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113821
AA Change: V245A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109452
Gene: ENSMUSG00000033788
AA Change: V245A

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 696 761 6.3e-23 SMART
FerB 788 862 2.49e-44 SMART
DysFN 876 935 1.42e-22 SMART
DysFN 948 1004 2.65e-22 SMART
DysFC 1013 1051 1.33e-13 SMART
DysFC 1070 1103 1.1e-10 SMART
C2 1155 1263 2.63e-15 SMART
C2 1332 1439 7.13e0 SMART
C2 1581 1680 2.52e-12 SMART
C2 1814 1943 1.55e-3 SMART
transmembrane domain 2047 2069 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113823
AA Change: V276A

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109454
Gene: ENSMUSG00000033788
AA Change: V276A

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 4.84e-14 SMART
FerI 336 407 5.3e-39 SMART
C2 413 527 2.96e-9 SMART
FerA 713 778 6.3e-23 SMART
FerB 805 879 2.49e-44 SMART
DysFN 893 952 1.42e-22 SMART
DysFN 965 1021 2.65e-22 SMART
DysFC 1030 1068 1.33e-13 SMART
DysFC 1087 1120 1.1e-10 SMART
C2 1172 1280 2.63e-15 SMART
C2 1349 1456 7.13e0 SMART
C2 1598 1697 2.52e-12 SMART
C2 1831 1960 1.55e-3 SMART
transmembrane domain 2064 2086 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153860
AA Change: V245A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145518
Gene: ENSMUSG00000033788
AA Change: V245A

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 3.2e-16 SMART
FerI 305 376 2.6e-43 SMART
C2 382 496 7.4e-12 SMART
FerA 696 761 3.1e-27 SMART
FerB 788 862 1.2e-48 SMART
DysFN 876 935 5.3e-25 SMART
DysFN 948 1004 9.6e-25 SMART
DysFC 1013 1051 4.7e-16 SMART
DysFC 1070 1103 4.1e-13 SMART
C2 1155 1263 1.7e-17 SMART
C2 1332 1439 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168387
AA Change: V245A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132297
Gene: ENSMUSG00000033788
AA Change: V245A

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 704 769 6.3e-23 SMART
FerB 796 870 2.49e-44 SMART
DysFN 884 943 1.42e-22 SMART
DysFN 956 1012 2.65e-22 SMART
DysFC 1021 1059 1.33e-13 SMART
DysFC 1078 1111 1.1e-10 SMART
C2 1163 1271 2.63e-15 SMART
C2 1340 1447 7.13e0 SMART
C2 1589 1688 2.52e-12 SMART
C2 1822 1951 1.55e-3 SMART
transmembrane domain 2055 2077 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203695
AA Change: V277A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145292
Gene: ENSMUSG00000033788
AA Change: V277A

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 3.2e-16 SMART
FerI 337 408 2.6e-43 SMART
C2 414 528 7.4e-12 SMART
FerA 728 793 3.1e-27 SMART
FerB 820 894 1.2e-48 SMART
DysFN 908 967 5.3e-25 SMART
DysFN 980 1036 9.6e-25 SMART
DysFC 1045 1083 4.7e-16 SMART
DysFC 1102 1135 4.1e-13 SMART
C2 1187 1295 1.7e-17 SMART
C2 1364 1471 4.7e-2 SMART
C2 1613 1712 1.7e-14 SMART
C2 1846 1975 1.1e-5 SMART
Pfam:Ferlin_C 2005 2109 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203803
AA Change: V276A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145511
Gene: ENSMUSG00000033788
AA Change: V276A

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 7.4e-12 SMART
FerA 727 792 3.1e-27 SMART
FerB 819 893 1.2e-48 SMART
DysFN 907 966 5.3e-25 SMART
DysFN 979 1035 9.6e-25 SMART
DysFC 1044 1082 4.7e-16 SMART
DysFC 1101 1134 4.1e-13 SMART
C2 1186 1294 1.7e-17 SMART
C2 1353 1460 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204354
AA Change: V246A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144705
Gene: ENSMUSG00000033788
AA Change: V246A

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 2e-11 SMART
FerA 683 748 3.1e-27 SMART
FerB 775 849 1.2e-48 SMART
DysFN 863 922 5.3e-25 SMART
DysFN 935 991 9.6e-25 SMART
DysFC 1000 1038 4.7e-16 SMART
DysFC 1057 1090 4.1e-13 SMART
C2 1142 1250 1.7e-17 SMART
C2 1319 1426 4.7e-2 SMART
C2 1589 1688 1.7e-14 SMART
C2 1822 1951 1.1e-5 SMART
Pfam:Ferlin_C 1981 2085 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204591
AA Change: V276A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144970
Gene: ENSMUSG00000033788
AA Change: V276A

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 2e-11 SMART
FerA 713 778 3.1e-27 SMART
FerB 805 879 1.2e-48 SMART
DysFN 893 952 5.3e-25 SMART
DysFN 965 1021 9.6e-25 SMART
DysFC 1030 1068 4.7e-16 SMART
DysFC 1087 1120 4.1e-13 SMART
C2 1172 1280 1.7e-17 SMART
C2 1349 1456 4.7e-2 SMART
C2 1619 1718 1.7e-14 SMART
C2 1852 1981 1.1e-5 SMART
Pfam:Ferlin_C 2011 2115 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204987
AA Change: V246A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144748
Gene: ENSMUSG00000033788
AA Change: V246A

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 7.4e-12 SMART
FerA 697 762 3.1e-27 SMART
FerB 789 863 1.2e-48 SMART
DysFN 877 936 5.3e-25 SMART
DysFN 949 1005 9.6e-25 SMART
DysFC 1014 1052 4.7e-16 SMART
DysFC 1071 1104 4.1e-13 SMART
C2 1156 1264 1.7e-17 SMART
C2 1333 1440 4.7e-2 SMART
C2 1603 1702 1.7e-14 SMART
C2 1836 1965 1.1e-5 SMART
Pfam:Ferlin_C 1995 2099 4.4e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes display dystrophic muscle changes and progressive muscle weakness developing over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Dysf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Dysf APN 6 84108099 missense probably damaging 1.00
IGL00340:Dysf APN 6 84141951 missense probably benign 0.02
IGL00429:Dysf APN 6 84189844 missense probably damaging 1.00
IGL00465:Dysf APN 6 84199848 critical splice donor site probably null
IGL00800:Dysf APN 6 84149998 missense probably damaging 1.00
IGL01069:Dysf APN 6 84199785 missense possibly damaging 0.94
IGL01094:Dysf APN 6 84194386 missense probably damaging 1.00
IGL01420:Dysf APN 6 84149759 nonsense probably null
IGL01649:Dysf APN 6 84199839 missense probably damaging 1.00
IGL01923:Dysf APN 6 84210829 makesense probably null
IGL01991:Dysf APN 6 84113618 missense probably damaging 1.00
IGL01999:Dysf APN 6 84113618 missense probably damaging 1.00
IGL02002:Dysf APN 6 84210787 splice site probably benign
IGL02136:Dysf APN 6 84108167 missense probably benign 0.43
IGL02318:Dysf APN 6 84186464 missense possibly damaging 0.50
IGL02378:Dysf APN 6 84111905 missense probably damaging 1.00
IGL02404:Dysf APN 6 84116061 missense probably damaging 1.00
IGL02416:Dysf APN 6 84192914 missense possibly damaging 0.92
IGL02535:Dysf APN 6 84149697 missense possibly damaging 0.45
IGL02553:Dysf APN 6 84130127 missense possibly damaging 0.95
IGL02559:Dysf APN 6 84067446 splice site probably benign
IGL02563:Dysf APN 6 84186516 splice site probably benign
IGL02647:Dysf APN 6 84137373 missense probably damaging 1.00
IGL02820:Dysf APN 6 84100205 missense probably damaging 0.99
IGL02858:Dysf APN 6 84099489 missense probably benign 0.01
IGL02860:Dysf APN 6 84190898 critical splice donor site probably null
IGL02861:Dysf APN 6 84039537 missense probably damaging 0.99
IGL03008:Dysf APN 6 84073894 missense probably benign 0.01
IGL03023:Dysf APN 6 84193007 missense probably damaging 1.00
IGL03074:Dysf APN 6 84188226 missense probably benign 0.25
IGL03342:Dysf APN 6 84190872 missense probably benign
PIT4305001:Dysf UTSW 6 84100234 nonsense probably null
R0067:Dysf UTSW 6 84063331 missense possibly damaging 0.58
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0124:Dysf UTSW 6 84065102 splice site probably benign
R0219:Dysf UTSW 6 84129461 splice site probably benign
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0426:Dysf UTSW 6 84149757 missense probably damaging 1.00
R0455:Dysf UTSW 6 84140667 missense probably benign 0.29
R0482:Dysf UTSW 6 84152405 missense probably benign 0.03
R0545:Dysf UTSW 6 84099461 missense probably damaging 0.99
R0625:Dysf UTSW 6 84111987 splice site probably null
R0676:Dysf UTSW 6 84113336 missense probably benign 0.07
R0699:Dysf UTSW 6 84190846 missense probably benign 0.00
R1165:Dysf UTSW 6 84067069 missense probably damaging 0.98
R1455:Dysf UTSW 6 84113386 missense probably benign 0.01
R1582:Dysf UTSW 6 84097767 missense probably damaging 1.00
R1584:Dysf UTSW 6 84067047 missense probably benign 0.04
R1605:Dysf UTSW 6 84106941 missense probably damaging 0.96
R1674:Dysf UTSW 6 84179715 missense probably benign 0.01
R1739:Dysf UTSW 6 84112235 critical splice donor site probably null
R1765:Dysf UTSW 6 84190902 splice site probably null
R1813:Dysf UTSW 6 84151924 missense possibly damaging 0.83
R1900:Dysf UTSW 6 84039567 missense probably damaging 0.97
R1960:Dysf UTSW 6 84073903 missense probably benign 0.12
R2216:Dysf UTSW 6 84207245 splice site probably null
R2242:Dysf UTSW 6 84186509 critical splice donor site probably null
R2243:Dysf UTSW 6 84186509 critical splice donor site probably null
R2245:Dysf UTSW 6 84186509 critical splice donor site probably null
R2246:Dysf UTSW 6 84186509 critical splice donor site probably null
R2280:Dysf UTSW 6 84064494 missense probably damaging 0.99
R2374:Dysf UTSW 6 84097729 missense probably damaging 1.00
R2403:Dysf UTSW 6 84039567 missense possibly damaging 0.84
R2763:Dysf UTSW 6 84106932 missense probably benign 0.00
R2895:Dysf UTSW 6 84186509 critical splice donor site probably null
R2916:Dysf UTSW 6 84186509 critical splice donor site probably null
R2918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3402:Dysf UTSW 6 84186509 critical splice donor site probably null
R3403:Dysf UTSW 6 84186509 critical splice donor site probably null
R3434:Dysf UTSW 6 84070888 missense probably benign 0.00
R3772:Dysf UTSW 6 84152351 missense possibly damaging 0.63
R3781:Dysf UTSW 6 84186509 critical splice donor site probably null
R3789:Dysf UTSW 6 84186509 critical splice donor site probably null
R3822:Dysf UTSW 6 84207088 splice site probably benign
R3918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3919:Dysf UTSW 6 84186509 critical splice donor site probably null
R3939:Dysf UTSW 6 84186509 critical splice donor site probably null
R3942:Dysf UTSW 6 84186509 critical splice donor site probably null
R4177:Dysf UTSW 6 84067031 nonsense probably null
R4179:Dysf UTSW 6 84186509 critical splice donor site probably null
R4180:Dysf UTSW 6 84186509 critical splice donor site probably null
R4299:Dysf UTSW 6 84068077 missense possibly damaging 0.78
R4419:Dysf UTSW 6 84207242 critical splice donor site probably null
R4446:Dysf UTSW 6 84205872 missense probably damaging 1.00
R4577:Dysf UTSW 6 84137326 missense probably damaging 1.00
R4680:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4708:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4709:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4710:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4725:Dysf UTSW 6 84097756 missense probably damaging 1.00
R4742:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4743:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4787:Dysf UTSW 6 84203328 nonsense probably null
R4850:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4868:Dysf UTSW 6 84179693 missense probably damaging 1.00
R4871:Dysf UTSW 6 84067023 missense possibly damaging 0.93
R4951:Dysf UTSW 6 84114120 critical splice donor site probably null
R4952:Dysf UTSW 6 84149986 missense possibly damaging 0.79
R5009:Dysf UTSW 6 84151986 missense probably damaging 1.00
R5072:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5073:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5074:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5252:Dysf UTSW 6 84186468 missense probably damaging 0.98
R5260:Dysf UTSW 6 84150034 missense probably damaging 1.00
R5447:Dysf UTSW 6 84195263 missense probably damaging 0.98
R5501:Dysf UTSW 6 84087818 missense probably damaging 0.99
R5533:Dysf UTSW 6 84186471 missense probably damaging 0.99
R5611:Dysf UTSW 6 84064878 missense probably damaging 0.98
R5618:Dysf UTSW 6 84106824 missense probably benign 0.03
R5884:Dysf UTSW 6 84186081 missense probably damaging 1.00
R5927:Dysf UTSW 6 84207212 missense probably damaging 1.00
R6045:Dysf UTSW 6 84114072 missense probably damaging 0.99
R6056:Dysf UTSW 6 84106862 missense probably benign
R6084:Dysf UTSW 6 84019604 missense probably damaging 0.98
R6084:Dysf UTSW 6 84112119 missense probably damaging 1.00
R6146:Dysf UTSW 6 84203199 missense probably damaging 0.96
R6220:Dysf UTSW 6 84149745 missense probably damaging 0.97
R6232:Dysf UTSW 6 84098253 missense probably benign 0.26
R6247:Dysf UTSW 6 84066999 missense probably damaging 1.00
R6298:Dysf UTSW 6 84107136 splice site probably null
R6306:Dysf UTSW 6 84137266 missense possibly damaging 0.91
R6377:Dysf UTSW 6 84008963 missense probably benign
R6415:Dysf UTSW 6 84140042 missense probably damaging 1.00
R6444:Dysf UTSW 6 84190840 missense probably benign 0.36
R6470:Dysf UTSW 6 84066944 missense possibly damaging 0.93
R6504:Dysf UTSW 6 84008925 missense probably benign 0.03
R6557:Dysf UTSW 6 84186384 missense probably damaging 0.99
R6665:Dysf UTSW 6 84130116 missense probably benign
R6701:Dysf UTSW 6 84112190 missense probably damaging 1.00
R6776:Dysf UTSW 6 84064894 missense possibly damaging 0.88
R6909:Dysf UTSW 6 84192938 missense probably damaging 1.00
R7007:Dysf UTSW 6 84113980 missense probably damaging 1.00
R7013:Dysf UTSW 6 84137358 missense probably damaging 1.00
R7035:Dysf UTSW 6 84186392 missense probably benign 0.02
R7094:Dysf UTSW 6 84100202 missense probably benign 0.43
R7124:Dysf UTSW 6 84190901 splice site probably null
R7156:Dysf UTSW 6 84087876 critical splice donor site probably null
R7261:Dysf UTSW 6 84193010 missense probably damaging 0.98
R7296:Dysf UTSW 6 84106898 missense probably benign 0.33
R7356:Dysf UTSW 6 84067461 missense probably damaging 1.00
R7359:Dysf UTSW 6 84195324 splice site probably null
R7384:Dysf UTSW 6 84114105 missense probably benign 0.17
R7409:Dysf UTSW 6 84149682 missense probably benign 0.00
R7449:Dysf UTSW 6 84137380 missense possibly damaging 0.90
R7476:Dysf UTSW 6 84064896 missense probably benign 0.08
R7496:Dysf UTSW 6 84067478 missense probably benign 0.43
R7573:Dysf UTSW 6 84130122 missense possibly damaging 0.59
R7616:Dysf UTSW 6 84101963 missense probably benign 0.01
R7684:Dysf UTSW 6 84100135 missense probably benign 0.00
R7808:Dysf UTSW 6 84070929 missense possibly damaging 0.86
R7836:Dysf UTSW 6 84137398 missense probably damaging 1.00
R7868:Dysf UTSW 6 84114099 missense probably benign 0.00
R7873:Dysf UTSW 6 84083765 missense probably benign
R7956:Dysf UTSW 6 84008996 missense probably benign 0.01
R8130:Dysf UTSW 6 84137376 missense probably damaging 0.97
R8357:Dysf UTSW 6 84188245 missense probably benign 0.01
R8383:Dysf UTSW 6 84019583 missense probably damaging 1.00
R8457:Dysf UTSW 6 84188245 missense probably benign 0.01
X0063:Dysf UTSW 6 84063354 missense probably damaging 0.97
X0066:Dysf UTSW 6 84114102 missense possibly damaging 0.77
Z1176:Dysf UTSW 6 84072685 missense probably damaging 1.00
Z1177:Dysf UTSW 6 84064523 missense probably benign
Z1177:Dysf UTSW 6 84087817 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AAGTTGTCAGTGAGCTGGTC -3'
(R):5'- ACTGGTCTTGGCTCTCACAC -3'

Sequencing Primer
(F):5'- GCTGGAACTCACTCTGTAGACTAG -3'
(R):5'- TCTCACACGCCAAGTTGG -3'
Posted On2015-11-11