Incidental Mutation 'R4749:Mcm2'
ID357386
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Nameminichromosome maintenance complex component 2
SynonymsBM28, CDCL1, Mcmd2
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4749 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88883474-88898780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88891991 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 293 (E293G)
Ref Sequence ENSEMBL: ENSMUSP00000061923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058011
AA Change: E293G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: E293G

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably benign
Transcript: ENSMUST00000205165
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88893401 missense probably benign 0.04
IGL01082:Mcm2 APN 6 88887877 missense probably benign 0.05
IGL01451:Mcm2 APN 6 88891966 splice site probably benign
IGL01534:Mcm2 APN 6 88887718 critical splice donor site probably null
IGL01670:Mcm2 APN 6 88887632 unclassified probably benign
IGL01724:Mcm2 APN 6 88886062 missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88891726 missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88888236 nonsense probably null
R0254:Mcm2 UTSW 6 88884016 missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88892078 missense probably benign 0.12
R1740:Mcm2 UTSW 6 88884044 missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88889788 missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88891803 missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88888252 missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88887804 missense possibly damaging 0.53
R5267:Mcm2 UTSW 6 88897450 missense probably benign
R5701:Mcm2 UTSW 6 88893091 missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88884071 missense probably benign 0.05
R6118:Mcm2 UTSW 6 88887836 missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88889909 critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88885862 missense probably benign 0.00
R6550:Mcm2 UTSW 6 88886959 critical splice donor site probably null
R7184:Mcm2 UTSW 6 88891794 missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88887946 missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88892057 missense probably damaging 1.00
R8215:Mcm2 UTSW 6 88897311 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTACAAAGTTGCACTTGCTACAG -3'
(R):5'- TTATGAAGACCTGGCAGCCC -3'

Sequencing Primer
(F):5'- ACTTGACCATGCTGAGCTG -3'
(R):5'- CCCGGGAGCACGTGTTG -3'
Posted On2015-11-11