Incidental Mutation 'R4749:Muc5b'
ID357392
Institutional Source Beutler Lab
Gene Symbol Muc5b
Ensembl Gene ENSMUSG00000066108
Gene Namemucin 5, subtype B, tracheobronchial
SynonymsMUC5, MUC9, 2300002I04Rik
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R4749 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141839070-141873084 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 141861448 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 2710 (Y2710*)
Ref Sequence ENSEMBL: ENSMUSP00000128276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165147]
Predicted Effect probably null
Transcript: ENSMUST00000165147
AA Change: Y2710*
SMART Domains Protein: ENSMUSP00000128276
Gene: ENSMUSG00000066108
AA Change: Y2710*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWD 73 228 1.12e-25 SMART
C8 267 330 7.26e-8 SMART
Pfam:TIL 333 389 1.1e-13 PFAM
VWC 391 459 1.35e-1 SMART
VWD 418 582 2.87e-37 SMART
C8 619 693 2.53e-30 SMART
Pfam:TIL 699 756 2.6e-10 PFAM
VWC 758 823 1.26e0 SMART
VWC 861 930 1.58e-7 SMART
VWD 888 1048 3e-40 SMART
C8 1084 1158 3.75e-33 SMART
low complexity region 1314 1328 N/A INTRINSIC
Pfam:Mucin2_WxxW 1345 1432 6.7e-27 PFAM
low complexity region 1447 1468 N/A INTRINSIC
low complexity region 1498 1517 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
Pfam:Mucin2_WxxW 1574 1663 2.1e-26 PFAM
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1728 1745 N/A INTRINSIC
low complexity region 1778 1831 N/A INTRINSIC
Pfam:Mucin2_WxxW 1870 1959 2.7e-26 PFAM
low complexity region 1967 1990 N/A INTRINSIC
low complexity region 2024 2041 N/A INTRINSIC
low complexity region 2074 2127 N/A INTRINSIC
Pfam:Mucin2_WxxW 2184 2273 2.1e-26 PFAM
low complexity region 2281 2304 N/A INTRINSIC
low complexity region 2338 2355 N/A INTRINSIC
low complexity region 2388 2441 N/A INTRINSIC
Pfam:Mucin2_WxxW 2498 2587 2.1e-26 PFAM
low complexity region 2596 2618 N/A INTRINSIC
low complexity region 2623 2654 N/A INTRINSIC
low complexity region 2660 2681 N/A INTRINSIC
Pfam:Mucin2_WxxW 2687 2776 3.8e-25 PFAM
low complexity region 2781 2796 N/A INTRINSIC
low complexity region 2958 3009 N/A INTRINSIC
Pfam:Mucin2_WxxW 3066 3155 2.6e-26 PFAM
low complexity region 3220 3237 N/A INTRINSIC
low complexity region 3270 3317 N/A INTRINSIC
Pfam:Mucin2_WxxW 3380 3469 3.4e-26 PFAM
low complexity region 3509 3529 N/A INTRINSIC
low complexity region 3546 3562 N/A INTRINSIC
low complexity region 3568 3591 N/A INTRINSIC
Pfam:Mucin2_WxxW 3624 3713 2.6e-27 PFAM
Pfam:Mucin2_WxxW 3778 3867 3.2e-24 PFAM
low complexity region 3883 3900 N/A INTRINSIC
low complexity region 3910 3934 N/A INTRINSIC
low complexity region 3959 3976 N/A INTRINSIC
low complexity region 4033 4053 N/A INTRINSIC
VWD 4111 4283 6.75e-34 SMART
C8 4336 4403 4.26e-14 SMART
VWC 4461 4530 7.06e-5 SMART
VWC 4570 4631 6.53e-9 SMART
CT 4708 4790 2.93e-26 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele accumulate materials in the upper and lower airways leading to chronic infection and inflammation that does not resolve and results in premature death. Macrophage function is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Muc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Muc5b APN 7 141841392 missense unknown
IGL00677:Muc5b APN 7 141857894 nonsense probably null
IGL00740:Muc5b APN 7 141855598 missense unknown
IGL01084:Muc5b APN 7 141843449 splice site probably benign
IGL01384:Muc5b APN 7 141846818 missense unknown
IGL01447:Muc5b APN 7 141863094 missense probably benign 0.01
IGL01510:Muc5b APN 7 141859061 missense unknown
IGL01532:Muc5b APN 7 141870006 missense possibly damaging 0.96
IGL01556:Muc5b APN 7 141863240 missense probably benign 0.01
IGL01608:Muc5b APN 7 141846437 missense unknown
IGL01884:Muc5b APN 7 141868083 splice site probably benign
IGL01943:Muc5b APN 7 141861497 missense possibly damaging 0.71
IGL02039:Muc5b APN 7 141871164 missense possibly damaging 0.96
IGL02089:Muc5b APN 7 141863250 missense probably benign 0.04
IGL02110:Muc5b APN 7 141847716 nonsense probably null
IGL02123:Muc5b APN 7 141863757 missense possibly damaging 0.68
IGL02124:Muc5b APN 7 141855632 missense unknown
IGL02141:Muc5b APN 7 141853367 missense unknown
IGL02409:Muc5b APN 7 141861338 missense possibly damaging 0.53
IGL02448:Muc5b APN 7 141868489 missense possibly damaging 0.53
IGL02503:Muc5b APN 7 141867667 missense probably benign 0.33
IGL02504:Muc5b APN 7 141846440 missense unknown
IGL02528:Muc5b APN 7 141864017 missense probably benign 0.01
IGL02534:Muc5b APN 7 141844719 missense unknown
IGL02565:Muc5b APN 7 141857867 missense unknown
IGL02630:Muc5b APN 7 141863231 missense probably benign 0.03
IGL02881:Muc5b APN 7 141857712 missense unknown
IGL02963:Muc5b APN 7 141864264 missense probably damaging 1.00
IGL03003:Muc5b APN 7 141863614 missense probably benign 0.03
IGL03013:Muc5b APN 7 141863928 missense possibly damaging 0.68
IGL03102:Muc5b APN 7 141863069 missense probably benign 0.35
IGL03114:Muc5b APN 7 141858819 nonsense probably null
IGL03150:Muc5b APN 7 141865509 missense possibly damaging 0.53
IGL03185:Muc5b APN 7 141862822 missense possibly damaging 0.83
IGL03299:Muc5b APN 7 141841380 missense unknown
IGL03336:Muc5b APN 7 141864363 missense probably damaging 1.00
IGL03370:Muc5b APN 7 141864777 missense probably benign 0.34
IGL03375:Muc5b APN 7 141861962 missense possibly damaging 0.53
IGL03393:Muc5b APN 7 141864138 missense probably benign 0.21
profligate UTSW 7 141857822 nonsense probably null
wasteful UTSW 7 141858161 missense unknown
R0045:Muc5b UTSW 7 141856818 missense unknown
R0256:Muc5b UTSW 7 141841395 missense unknown
R0256:Muc5b UTSW 7 141843258 missense unknown
R0321:Muc5b UTSW 7 141862235 missense probably benign 0.19
R0391:Muc5b UTSW 7 141865082 missense possibly damaging 0.73
R0458:Muc5b UTSW 7 141864972 missense probably benign 0.20
R0491:Muc5b UTSW 7 141862015 missense probably benign 0.01
R0543:Muc5b UTSW 7 141851785 missense unknown
R0583:Muc5b UTSW 7 141856698 nonsense probably null
R0611:Muc5b UTSW 7 141862436 missense probably benign 0.18
R0625:Muc5b UTSW 7 141846427 missense unknown
R0655:Muc5b UTSW 7 141863942 missense probably benign 0.01
R0845:Muc5b UTSW 7 141850446 splice site probably null
R0863:Muc5b UTSW 7 141867717 missense probably benign 0.18
R0965:Muc5b UTSW 7 141863802 missense possibly damaging 0.92
R0988:Muc5b UTSW 7 141871795 missense probably benign 0.03
R1140:Muc5b UTSW 7 141858996 missense unknown
R1209:Muc5b UTSW 7 141857910 missense unknown
R1333:Muc5b UTSW 7 141868407 missense possibly damaging 0.53
R1337:Muc5b UTSW 7 141858624 missense unknown
R1385:Muc5b UTSW 7 141862137 missense probably benign 0.00
R1463:Muc5b UTSW 7 141859080 missense unknown
R1471:Muc5b UTSW 7 141843234 missense unknown
R1617:Muc5b UTSW 7 141863524 nonsense probably null
R1736:Muc5b UTSW 7 141859107 missense unknown
R1752:Muc5b UTSW 7 141867751 missense possibly damaging 0.96
R1804:Muc5b UTSW 7 141863780 missense possibly damaging 0.68
R1806:Muc5b UTSW 7 141865493 missense possibly damaging 0.68
R1895:Muc5b UTSW 7 141857645 missense unknown
R1902:Muc5b UTSW 7 141864105 missense possibly damaging 0.77
R1919:Muc5b UTSW 7 141846031 missense unknown
R1924:Muc5b UTSW 7 141868223 missense possibly damaging 0.53
R1942:Muc5b UTSW 7 141857684 missense unknown
R1959:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1960:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1976:Muc5b UTSW 7 141863154 missense probably benign 0.01
R2080:Muc5b UTSW 7 141869754 missense probably benign 0.33
R2178:Muc5b UTSW 7 141864116 missense possibly damaging 0.58
R2184:Muc5b UTSW 7 141858864 nonsense probably null
R2229:Muc5b UTSW 7 141861644 missense possibly damaging 0.71
R2237:Muc5b UTSW 7 141862089 missense probably benign 0.00
R2509:Muc5b UTSW 7 141859061 missense unknown
R2510:Muc5b UTSW 7 141859061 missense unknown
R2512:Muc5b UTSW 7 141859076 missense unknown
R2888:Muc5b UTSW 7 141861554 missense probably damaging 0.98
R3054:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3055:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3108:Muc5b UTSW 7 141858759 missense unknown
R3109:Muc5b UTSW 7 141858759 missense unknown
R3113:Muc5b UTSW 7 141846134 missense unknown
R3551:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141867705 missense probably benign 0.18
R3622:Muc5b UTSW 7 141851858 splice site probably benign
R3700:Muc5b UTSW 7 141847249 missense unknown
R3734:Muc5b UTSW 7 141859037 nonsense probably null
R3785:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3786:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3788:Muc5b UTSW 7 141863834 missense possibly damaging 0.68
R3810:Muc5b UTSW 7 141864126 missense possibly damaging 0.58
R3834:Muc5b UTSW 7 141859181 missense unknown
R3835:Muc5b UTSW 7 141859181 missense unknown
R3850:Muc5b UTSW 7 141862638 missense possibly damaging 0.95
R3877:Muc5b UTSW 7 141857552 missense unknown
R3909:Muc5b UTSW 7 141849498 missense unknown
R3964:Muc5b UTSW 7 141866968 missense possibly damaging 0.73
R4014:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4015:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4017:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4042:Muc5b UTSW 7 141864887 missense possibly damaging 0.92
R4200:Muc5b UTSW 7 141858925 nonsense probably null
R4230:Muc5b UTSW 7 141863522 missense probably benign 0.03
R4400:Muc5b UTSW 7 141861387 missense possibly damaging 0.92
R4455:Muc5b UTSW 7 141858818 missense unknown
R4484:Muc5b UTSW 7 141868450 missense possibly damaging 0.73
R4630:Muc5b UTSW 7 141857984 missense unknown
R4646:Muc5b UTSW 7 141862640 missense probably benign 0.34
R4658:Muc5b UTSW 7 141841398 missense unknown
R4667:Muc5b UTSW 7 141842379 missense unknown
R4690:Muc5b UTSW 7 141842294 missense unknown
R4697:Muc5b UTSW 7 141857361 missense unknown
R4711:Muc5b UTSW 7 141846033 missense unknown
R4713:Muc5b UTSW 7 141849079 nonsense probably null
R4753:Muc5b UTSW 7 141856853 missense unknown
R4782:Muc5b UTSW 7 141847716 nonsense probably null
R4795:Muc5b UTSW 7 141849567 missense unknown
R4796:Muc5b UTSW 7 141864246 missense possibly damaging 0.52
R4799:Muc5b UTSW 7 141847716 nonsense probably null
R4824:Muc5b UTSW 7 141864185 missense probably damaging 1.00
R4825:Muc5b UTSW 7 141868465 missense possibly damaging 0.96
R5068:Muc5b UTSW 7 141858608 missense unknown
R5073:Muc5b UTSW 7 141859262 missense unknown
R5074:Muc5b UTSW 7 141859262 missense unknown
R5107:Muc5b UTSW 7 141855531 missense unknown
R5152:Muc5b UTSW 7 141865531 missense possibly damaging 0.53
R5183:Muc5b UTSW 7 141850810 missense unknown
R5191:Muc5b UTSW 7 141858539 missense unknown
R5254:Muc5b UTSW 7 141864540 missense probably benign 0.09
R5320:Muc5b UTSW 7 141859001 missense unknown
R5352:Muc5b UTSW 7 141864558 missense possibly damaging 0.66
R5378:Muc5b UTSW 7 141862203 missense unknown
R5417:Muc5b UTSW 7 141858044 missense unknown
R5548:Muc5b UTSW 7 141863942 missense probably benign 0.01
R5551:Muc5b UTSW 7 141868503 missense possibly damaging 0.73
R5562:Muc5b UTSW 7 141847238 missense unknown
R5580:Muc5b UTSW 7 141861347 missense possibly damaging 0.53
R5629:Muc5b UTSW 7 141861299 missense possibly damaging 0.73
R5758:Muc5b UTSW 7 141858983 missense unknown
R5783:Muc5b UTSW 7 141858428 nonsense probably null
R5795:Muc5b UTSW 7 141871741 missense possibly damaging 0.96
R5796:Muc5b UTSW 7 141857396 missense unknown
R5797:Muc5b UTSW 7 141851582 missense unknown
R5806:Muc5b UTSW 7 141862835 missense possibly damaging 0.68
R5888:Muc5b UTSW 7 141858421 missense unknown
R5910:Muc5b UTSW 7 141861311 missense possibly damaging 0.53
R5956:Muc5b UTSW 7 141864173 missense probably damaging 0.99
R5970:Muc5b UTSW 7 141856712 missense unknown
R5990:Muc5b UTSW 7 141858161 missense unknown
R5999:Muc5b UTSW 7 141857379 missense unknown
R6001:Muc5b UTSW 7 141872381 missense possibly damaging 0.72
R6053:Muc5b UTSW 7 141864708 missense probably benign 0.07
R6073:Muc5b UTSW 7 141849060 missense unknown
R6073:Muc5b UTSW 7 141858288 missense unknown
R6112:Muc5b UTSW 7 141863305 missense probably benign 0.01
R6153:Muc5b UTSW 7 141861444 missense possibly damaging 0.71
R6164:Muc5b UTSW 7 141863345 missense possibly damaging 0.73
R6172:Muc5b UTSW 7 141858776 missense unknown
R6178:Muc5b UTSW 7 141856342 missense probably null
R6196:Muc5b UTSW 7 141851596 missense unknown
R6213:Muc5b UTSW 7 141862166 missense probably benign 0.00
R6213:Muc5b UTSW 7 141867619 missense possibly damaging 0.92
R6344:Muc5b UTSW 7 141862971 missense possibly damaging 0.62
R6400:Muc5b UTSW 7 141858665 missense unknown
R6414:Muc5b UTSW 7 141859097 missense unknown
R6521:Muc5b UTSW 7 141859171 nonsense probably null
R6658:Muc5b UTSW 7 141868507 critical splice donor site probably null
R6717:Muc5b UTSW 7 141857822 nonsense probably null
R6737:Muc5b UTSW 7 141857499 missense unknown
R6763:Muc5b UTSW 7 141862284 missense probably benign 0.01
R6817:Muc5b UTSW 7 141862913 missense probably benign 0.06
R6819:Muc5b UTSW 7 141858863 missense unknown
R6916:Muc5b UTSW 7 141864717 missense possibly damaging 0.71
R7030:Muc5b UTSW 7 141842455 missense unknown
R7116:Muc5b UTSW 7 141863750 missense probably benign 0.10
R7134:Muc5b UTSW 7 141857654 missense unknown
R7146:Muc5b UTSW 7 141863967 missense possibly damaging 0.96
R7168:Muc5b UTSW 7 141864017 missense probably benign 0.01
R7182:Muc5b UTSW 7 141842645 missense unknown
R7189:Muc5b UTSW 7 141861061 nonsense probably null
R7207:Muc5b UTSW 7 141862865 missense probably benign 0.01
R7232:Muc5b UTSW 7 141866129 missense possibly damaging 0.53
R7260:Muc5b UTSW 7 141842648 missense unknown
R7269:Muc5b UTSW 7 141857535 missense unknown
R7273:Muc5b UTSW 7 141851570 missense unknown
R7278:Muc5b UTSW 7 141857502 missense unknown
R7307:Muc5b UTSW 7 141842294 missense unknown
R7323:Muc5b UTSW 7 141858707 missense unknown
R7374:Muc5b UTSW 7 141863126 missense probably benign 0.10
R7376:Muc5b UTSW 7 141872550 missense possibly damaging 0.53
R7382:Muc5b UTSW 7 141858948 missense unknown
R7481:Muc5b UTSW 7 141861171 missense unknown
R7497:Muc5b UTSW 7 141861513 missense possibly damaging 0.92
R7554:Muc5b UTSW 7 141858776 missense unknown
R7571:Muc5b UTSW 7 141847249 missense unknown
R7598:Muc5b UTSW 7 141859262 missense unknown
R7609:Muc5b UTSW 7 141861729 missense possibly damaging 0.86
R7615:Muc5b UTSW 7 141864892 nonsense probably null
R7618:Muc5b UTSW 7 141867597 missense probably benign 0.01
R7651:Muc5b UTSW 7 141864023 missense possibly damaging 0.75
R7692:Muc5b UTSW 7 141853229 missense unknown
R7731:Muc5b UTSW 7 141857305 critical splice acceptor site probably null
R7746:Muc5b UTSW 7 141862239 missense probably benign 0.10
R7748:Muc5b UTSW 7 141847805 missense unknown
R7774:Muc5b UTSW 7 141842379 missense unknown
R7783:Muc5b UTSW 7 141857341 missense unknown
R7834:Muc5b UTSW 7 141859070 missense unknown
R7872:Muc5b UTSW 7 141846113 missense unknown
R7935:Muc5b UTSW 7 141846832 missense unknown
R8026:Muc5b UTSW 7 141863636 missense probably benign 0.03
R8036:Muc5b UTSW 7 141867741 missense possibly damaging 0.73
R8081:Muc5b UTSW 7 141864006 missense possibly damaging 0.88
R8096:Muc5b UTSW 7 141849555 missense unknown
R8101:Muc5b UTSW 7 141865175 missense possibly damaging 0.53
R8112:Muc5b UTSW 7 141862028 missense possibly damaging 0.53
R8131:Muc5b UTSW 7 141842409 missense unknown
R8170:Muc5b UTSW 7 141861000 missense unknown
R8171:Muc5b UTSW 7 141861000 missense unknown
R8191:Muc5b UTSW 7 141867684 missense probably benign 0.18
R8237:Muc5b UTSW 7 141857960 missense unknown
R8342:Muc5b UTSW 7 141860865 missense unknown
R8343:Muc5b UTSW 7 141864161 missense probably benign 0.28
R8389:Muc5b UTSW 7 141861779 missense possibly damaging 0.53
R8396:Muc5b UTSW 7 141851815 missense unknown
Z1088:Muc5b UTSW 7 141862214 missense probably benign 0.01
Z1176:Muc5b UTSW 7 141842705 missense unknown
Z1177:Muc5b UTSW 7 141863173 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTTCTTCTCTAGCCACAGG -3'
(R):5'- GGTATCTTCCTCACAGCAGAG -3'

Sequencing Primer
(F):5'- GGCACACCCAGAGAGACTC -3'
(R):5'- CACGGATGTGGTAGTTGAAAC -3'
Posted On2015-11-11