Incidental Mutation 'R4749:Pcnx2'
ID357400
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4749 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125887588 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 375 (S375G)
Ref Sequence ENSEMBL: ENSMUSP00000119965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239] [ENSMUST00000131127]
Predicted Effect probably damaging
Transcript: ENSMUST00000047239
AA Change: S375G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: S375G

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131127
AA Change: S375G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119965
Gene: ENSMUSG00000060212
AA Change: S375G

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 968 990 N/A INTRINSIC
transmembrane domain 1010 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187772
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
gallen UTSW 8 125891120 missense probably damaging 1.00
hotzone UTSW 8 125891141 missense probably benign 0.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 splice site probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 splice site probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
R7271:Pcnx2 UTSW 8 125886951 missense probably benign
R7326:Pcnx2 UTSW 8 125887083 missense probably damaging 1.00
R7373:Pcnx2 UTSW 8 125808027 missense probably damaging 1.00
R7397:Pcnx2 UTSW 8 125890885 splice site probably null
R7662:Pcnx2 UTSW 8 125818771 nonsense probably null
R7693:Pcnx2 UTSW 8 125887125 missense probably benign 0.09
R7726:Pcnx2 UTSW 8 125850330 missense probably benign 0.00
R7745:Pcnx2 UTSW 8 125851107 missense probably benign 0.04
R7792:Pcnx2 UTSW 8 125892018 missense possibly damaging 0.63
R7797:Pcnx2 UTSW 8 125785348 missense possibly damaging 0.70
R7921:Pcnx2 UTSW 8 125837863 missense probably benign
R7984:Pcnx2 UTSW 8 125759126 missense probably benign
R8098:Pcnx2 UTSW 8 125768301 missense probably damaging 1.00
R8277:Pcnx2 UTSW 8 125866016 missense probably damaging 1.00
R8312:Pcnx2 UTSW 8 125762850 missense possibly damaging 0.69
R8354:Pcnx2 UTSW 8 125761618 missense probably damaging 0.99
R8378:Pcnx2 UTSW 8 125760910 missense probably damaging 1.00
R8713:Pcnx2 UTSW 8 125818786 missense probably damaging 1.00
R8714:Pcnx2 UTSW 8 125773807 missense probably benign
R8753:Pcnx2 UTSW 8 125887260 missense probably benign 0.15
R8790:Pcnx2 UTSW 8 125877567 missense probably benign
R8925:Pcnx2 UTSW 8 125887920 missense probably benign 0.01
R8927:Pcnx2 UTSW 8 125887920 missense probably benign 0.01
RF018:Pcnx2 UTSW 8 125877519 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125761654 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125838014 missense probably benign 0.30
Z1177:Pcnx2 UTSW 8 125887960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCCTCCGTTAACTCAAGGGTG -3'
(R):5'- AACAGATCGCCTCAGGACAG -3'

Sequencing Primer
(F):5'- GATCAAAGGGATTCTGACCTGCTC -3'
(R):5'- TGCTGTCAGTGCAACACAGTC -3'
Posted On2015-11-11