Incidental Mutation 'R4749:Hsp90b1'
ID 357408
Institutional Source Beutler Lab
Gene Symbol Hsp90b1
Ensembl Gene ENSMUSG00000020048
Gene Name heat shock protein 90, beta (Grp94), member 1
Synonyms ERp99, gp96, GRP94, tumor rejection antigen (gp96) 1, Tra-1, endoplasmin, 90 kDa, Targ2, Tra1
MMRRC Submission 041969-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4749 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86526705-86541308 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86537672 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 211 (V211A)
Ref Sequence ENSEMBL: ENSMUSP00000020238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020238] [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000129413] [ENSMUST00000217747]
AlphaFold P08113
Predicted Effect probably damaging
Transcript: ENSMUST00000020238
AA Change: V211A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020238
Gene: ENSMUSG00000020048
AA Change: V211A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
HATPase_c 96 255 4.96e-9 SMART
Pfam:HSP90 257 781 2.5e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061458
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075632
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129178
Predicted Effect probably benign
Transcript: ENSMUST00000129413
SMART Domains Protein: ENSMUSP00000122710
Gene: ENSMUSG00000020048

DomainStartEndE-ValueType
coiled coil region 9 35 N/A INTRINSIC
Pfam:HSP90 39 373 3.8e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174945
Predicted Effect probably benign
Transcript: ENSMUST00000217747
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of adenosine triphosphate(ATP)-metabolizing molecular chaperones with roles in stabilizing and folding other proteins. The encoded protein is localized to melanosomes and the endoplasmic reticulum. Expression of this protein is associated with a variety of pathogenic states, including tumor formation. There is a microRNA gene located within the 5' exon of this gene. There are pseudogenes for this gene on chromosomes 1 and 15. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before somite formation with failure of primitive streak formation, absence of the chorion and amnion, and failure of mesoderm formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,204,153 (GRCm39) D79E probably benign Het
Adgra2 A G 8: 27,604,225 (GRCm39) K472E probably damaging Het
Akap9 A G 5: 4,018,737 (GRCm39) D1106G probably benign Het
Arhgap35 T C 7: 16,232,551 (GRCm39) E1367G possibly damaging Het
Arsi A T 18: 61,050,533 (GRCm39) Y472F probably benign Het
Asxl3 A G 18: 22,649,826 (GRCm39) D605G probably damaging Het
Atp6v1e2 C T 17: 87,252,135 (GRCm39) D88N probably benign Het
BC061237 T A 14: 44,743,469 (GRCm39) V169E probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
C9 G A 15: 6,519,311 (GRCm39) V383I probably benign Het
Ccdc88a A G 11: 29,432,720 (GRCm39) K222R probably benign Het
Ccna2 T C 3: 36,620,391 (GRCm39) S421G probably benign Het
Cflar T G 1: 58,779,431 (GRCm39) V229G possibly damaging Het
Clcn1 A G 6: 42,267,131 (GRCm39) probably null Het
Col14a1 T A 15: 55,315,732 (GRCm39) F1342L unknown Het
Colq C T 14: 31,251,472 (GRCm39) R313H possibly damaging Het
Coro6 A G 11: 77,359,974 (GRCm39) E345G probably damaging Het
Cracd T C 5: 77,006,681 (GRCm39) V1014A unknown Het
Cyb561 A G 11: 105,826,708 (GRCm39) F182L probably benign Het
Dap3 A G 3: 88,833,617 (GRCm39) S317P probably benign Het
Dnah9 G A 11: 65,724,941 (GRCm39) A4404V probably damaging Het
Dsg4 A G 18: 20,579,888 (GRCm39) E31G possibly damaging Het
Dsn1 G A 2: 156,843,660 (GRCm39) L147F probably damaging Het
Dysf T C 6: 84,043,990 (GRCm39) V277A probably damaging Het
Eprs1 T A 1: 185,128,327 (GRCm39) I569K probably damaging Het
Erg T C 16: 95,162,029 (GRCm39) N342S probably damaging Het
Fam114a1 G A 5: 65,166,409 (GRCm39) D247N probably damaging Het
Fat2 A G 11: 55,202,294 (GRCm39) V260A probably benign Het
Foxn4 T C 5: 114,393,628 (GRCm39) D497G probably damaging Het
Fsip2 A G 2: 82,819,629 (GRCm39) I5121V probably benign Het
Gcn1 T A 5: 115,752,461 (GRCm39) D2155E probably benign Het
Glra1 C A 11: 55,427,210 (GRCm39) D42Y probably damaging Het
Gpr171 A G 3: 59,004,887 (GRCm39) V296A probably benign Het
Grid1 T A 14: 35,302,644 (GRCm39) S970T possibly damaging Het
Hcn3 A T 3: 89,057,370 (GRCm39) probably null Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Hsd3b3 G A 3: 98,649,931 (GRCm39) P131S probably damaging Het
Htr2c A G X: 145,976,793 (GRCm39) T163A probably benign Het
Ifi208 T A 1: 173,523,180 (GRCm39) D483E possibly damaging Het
Kbtbd6 T A 14: 79,690,727 (GRCm39) V474E possibly damaging Het
Kif21b T A 1: 136,072,487 (GRCm39) Y64* probably null Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Map3k10 T C 7: 27,357,786 (GRCm39) D664G possibly damaging Het
Map3k5 C A 10: 20,007,798 (GRCm39) S1201Y probably benign Het
Mcm2 T C 6: 88,868,973 (GRCm39) E293G possibly damaging Het
Med21 T A 6: 146,551,599 (GRCm39) probably null Het
Mettl18 T C 1: 163,824,354 (GRCm39) V225A probably benign Het
Mmp10 A T 9: 7,508,169 (GRCm39) I432F probably damaging Het
Muc5b T G 7: 141,415,185 (GRCm39) Y2710* probably null Het
Neurl4 A T 11: 69,801,894 (GRCm39) I1282F probably benign Het
Nipbl A T 15: 8,395,313 (GRCm39) H191Q possibly damaging Het
Nktr A G 9: 121,570,759 (GRCm39) D167G probably damaging Het
Nrap A G 19: 56,368,669 (GRCm39) I249T probably damaging Het
Nsfl1c A G 2: 151,351,526 (GRCm39) T297A probably benign Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Or1e1 G A 11: 73,245,322 (GRCm39) V248M probably damaging Het
Or4a39 C T 2: 89,236,599 (GRCm39) V275I probably benign Het
Or4k6 A G 14: 50,476,190 (GRCm39) S51P probably damaging Het
Or5b24 C T 19: 12,912,581 (GRCm39) H160Y probably benign Het
Or5d36 T A 2: 87,900,956 (GRCm39) I257L probably benign Het
Pcnx2 T C 8: 126,614,327 (GRCm39) S375G probably damaging Het
Pgap6 T C 17: 26,335,757 (GRCm39) F48S probably damaging Het
Phf2 A T 13: 48,975,185 (GRCm39) probably null Het
Piezo1 A T 8: 123,213,678 (GRCm39) M1739K possibly damaging Het
Piezo1 G T 8: 123,224,945 (GRCm39) Q654K probably damaging Het
Pml C T 9: 58,141,935 (GRCm39) R299H probably damaging Het
Ppp3cb A T 14: 20,574,130 (GRCm39) M236K probably damaging Het
Prkch T A 12: 73,739,734 (GRCm39) C203S probably damaging Het
Prob1 C T 18: 35,785,869 (GRCm39) R795H possibly damaging Het
Prr22 G C 17: 57,078,274 (GRCm39) E142D possibly damaging Het
Prss56 C A 1: 87,113,305 (GRCm39) A211E possibly damaging Het
Qser1 A C 2: 104,617,649 (GRCm39) S1054R probably benign Het
Rhbdl2 T C 4: 123,720,694 (GRCm39) probably null Het
Rhot2 C A 17: 26,063,248 (GRCm39) G19V probably damaging Het
Rp1l1 C T 14: 64,267,249 (GRCm39) T945M probably damaging Het
Ryr3 T C 2: 112,794,750 (GRCm39) T121A possibly damaging Het
Sdad1 C T 5: 92,452,836 (GRCm39) R134Q possibly damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sharpin T A 15: 76,231,767 (GRCm39) D314V probably damaging Het
Slc14a2 A T 18: 78,198,796 (GRCm39) L778Q probably damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc4a11 C A 2: 130,532,787 (GRCm39) R222L probably damaging Het
Slc7a10 C T 7: 34,900,187 (GRCm39) P502S probably damaging Het
Sort1 T G 3: 108,263,639 (GRCm39) Y812* probably null Het
Spata31d1b G A 13: 59,866,172 (GRCm39) V1107M probably damaging Het
Tcp10b G A 17: 13,289,832 (GRCm39) probably null Het
Tnc T C 4: 63,913,876 (GRCm39) D1312G possibly damaging Het
Tomm40l G A 1: 171,047,131 (GRCm39) R296* probably null Het
Topors A T 4: 40,261,015 (GRCm39) S756R unknown Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Ube2o T C 11: 116,432,734 (GRCm39) D744G probably benign Het
Vmn1r224 A G 17: 20,640,013 (GRCm39) I197V probably benign Het
Zc3h18 A T 8: 123,110,382 (GRCm39) D77V probably damaging Het
Other mutations in Hsp90b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Hsp90b1 APN 10 86,540,234 (GRCm39) missense probably benign 0.40
IGL01671:Hsp90b1 APN 10 86,540,189 (GRCm39) missense probably benign 0.07
IGL01673:Hsp90b1 APN 10 86,529,296 (GRCm39) missense probably damaging 0.99
IGL02097:Hsp90b1 APN 10 86,527,548 (GRCm39) unclassified probably benign
IGL02124:Hsp90b1 APN 10 86,541,222 (GRCm39) unclassified probably benign
IGL02257:Hsp90b1 APN 10 86,534,453 (GRCm39) missense probably damaging 1.00
IGL02339:Hsp90b1 APN 10 86,537,678 (GRCm39) missense probably damaging 1.00
IGL02342:Hsp90b1 APN 10 86,531,603 (GRCm39) critical splice acceptor site probably null
R0329:Hsp90b1 UTSW 10 86,530,019 (GRCm39) missense probably damaging 1.00
R0330:Hsp90b1 UTSW 10 86,530,019 (GRCm39) missense probably damaging 1.00
R0735:Hsp90b1 UTSW 10 86,531,612 (GRCm39) splice site probably benign
R1531:Hsp90b1 UTSW 10 86,532,659 (GRCm39) missense probably benign 0.02
R1540:Hsp90b1 UTSW 10 86,529,906 (GRCm39) missense probably damaging 1.00
R1711:Hsp90b1 UTSW 10 86,530,389 (GRCm39) missense probably damaging 1.00
R1797:Hsp90b1 UTSW 10 86,537,609 (GRCm39) missense possibly damaging 0.86
R2128:Hsp90b1 UTSW 10 86,531,570 (GRCm39) missense probably damaging 1.00
R2129:Hsp90b1 UTSW 10 86,531,570 (GRCm39) missense probably damaging 1.00
R2903:Hsp90b1 UTSW 10 86,539,349 (GRCm39) missense probably damaging 1.00
R4735:Hsp90b1 UTSW 10 86,529,819 (GRCm39) missense probably damaging 1.00
R5011:Hsp90b1 UTSW 10 86,532,617 (GRCm39) missense probably benign 0.37
R5650:Hsp90b1 UTSW 10 86,529,367 (GRCm39) missense probably damaging 1.00
R5950:Hsp90b1 UTSW 10 86,537,609 (GRCm39) missense possibly damaging 0.86
R6731:Hsp90b1 UTSW 10 86,537,769 (GRCm39) missense probably benign 0.01
R6835:Hsp90b1 UTSW 10 86,529,949 (GRCm39) missense probably damaging 1.00
R7038:Hsp90b1 UTSW 10 86,531,730 (GRCm39) missense probably damaging 0.99
R7250:Hsp90b1 UTSW 10 86,527,572 (GRCm39) missense unknown
R7343:Hsp90b1 UTSW 10 86,528,047 (GRCm39) missense probably damaging 1.00
R8027:Hsp90b1 UTSW 10 86,532,594 (GRCm39) missense probably damaging 0.97
R8126:Hsp90b1 UTSW 10 86,530,246 (GRCm39) missense probably damaging 0.99
R8336:Hsp90b1 UTSW 10 86,526,968 (GRCm39) makesense probably null
R8768:Hsp90b1 UTSW 10 86,541,169 (GRCm39) critical splice donor site probably null
R9024:Hsp90b1 UTSW 10 86,541,174 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGAGCTACCTCTTTTGTGGTC -3'
(R):5'- AACCTGCTGCATGTCACAGAC -3'

Sequencing Primer
(F):5'- GTGGTCTCCCATCAGCTTC -3'
(R):5'- TGCATGTCACAGACACGGG -3'
Posted On 2015-11-11