Incidental Mutation 'R4749:Hsp90b1'
ID 357408
Institutional Source Beutler Lab
Gene Symbol Hsp90b1
Ensembl Gene ENSMUSG00000020048
Gene Name heat shock protein 90, beta (Grp94), member 1
Synonyms ERp99, tumor rejection antigen (gp96) 1, Targ2, endoplasmin, Tra-1, Tra1, gp96, GRP94, 90 kDa
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4749 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86690209-86705509 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86701808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 211 (V211A)
Ref Sequence ENSEMBL: ENSMUSP00000020238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020238] [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000129413] [ENSMUST00000217747]
AlphaFold P08113
Predicted Effect probably damaging
Transcript: ENSMUST00000020238
AA Change: V211A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020238
Gene: ENSMUSG00000020048
AA Change: V211A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
HATPase_c 96 255 4.96e-9 SMART
Pfam:HSP90 257 781 2.5e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061458
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075632
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129178
Predicted Effect probably benign
Transcript: ENSMUST00000129413
SMART Domains Protein: ENSMUSP00000122710
Gene: ENSMUSG00000020048

DomainStartEndE-ValueType
coiled coil region 9 35 N/A INTRINSIC
Pfam:HSP90 39 373 3.8e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174945
Predicted Effect probably benign
Transcript: ENSMUST00000217747
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of adenosine triphosphate(ATP)-metabolizing molecular chaperones with roles in stabilizing and folding other proteins. The encoded protein is localized to melanosomes and the endoplasmic reticulum. Expression of this protein is associated with a variety of pathogenic states, including tumor formation. There is a microRNA gene located within the 5' exon of this gene. There are pseudogenes for this gene on chromosomes 1 and 15. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before somite formation with failure of primitive streak formation, absence of the chorion and amnion, and failure of mesoderm formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Hsp90b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Hsp90b1 APN 10 86704370 missense probably benign 0.40
IGL01671:Hsp90b1 APN 10 86704325 missense probably benign 0.07
IGL01673:Hsp90b1 APN 10 86693432 missense probably damaging 0.99
IGL02097:Hsp90b1 APN 10 86691684 unclassified probably benign
IGL02124:Hsp90b1 APN 10 86705358 unclassified probably benign
IGL02257:Hsp90b1 APN 10 86698589 missense probably damaging 1.00
IGL02339:Hsp90b1 APN 10 86701814 missense probably damaging 1.00
IGL02342:Hsp90b1 APN 10 86695739 critical splice acceptor site probably null
R0329:Hsp90b1 UTSW 10 86694155 missense probably damaging 1.00
R0330:Hsp90b1 UTSW 10 86694155 missense probably damaging 1.00
R0735:Hsp90b1 UTSW 10 86695748 splice site probably benign
R1531:Hsp90b1 UTSW 10 86696795 missense probably benign 0.02
R1540:Hsp90b1 UTSW 10 86694042 missense probably damaging 1.00
R1711:Hsp90b1 UTSW 10 86694525 missense probably damaging 1.00
R1797:Hsp90b1 UTSW 10 86701745 missense possibly damaging 0.86
R2128:Hsp90b1 UTSW 10 86695706 missense probably damaging 1.00
R2129:Hsp90b1 UTSW 10 86695706 missense probably damaging 1.00
R2903:Hsp90b1 UTSW 10 86703485 missense probably damaging 1.00
R4735:Hsp90b1 UTSW 10 86693955 missense probably damaging 1.00
R5011:Hsp90b1 UTSW 10 86696753 missense probably benign 0.37
R5650:Hsp90b1 UTSW 10 86693503 missense probably damaging 1.00
R5950:Hsp90b1 UTSW 10 86701745 missense possibly damaging 0.86
R6731:Hsp90b1 UTSW 10 86701905 missense probably benign 0.01
R6835:Hsp90b1 UTSW 10 86694085 missense probably damaging 1.00
R7038:Hsp90b1 UTSW 10 86695866 missense probably damaging 0.99
R7250:Hsp90b1 UTSW 10 86691708 missense unknown
R7343:Hsp90b1 UTSW 10 86692183 missense probably damaging 1.00
R8027:Hsp90b1 UTSW 10 86696730 missense probably damaging 0.97
R8126:Hsp90b1 UTSW 10 86694382 missense probably damaging 0.99
R8336:Hsp90b1 UTSW 10 86691104 makesense probably null
R8768:Hsp90b1 UTSW 10 86705305 critical splice donor site probably null
R9024:Hsp90b1 UTSW 10 86705310 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGAGCTACCTCTTTTGTGGTC -3'
(R):5'- AACCTGCTGCATGTCACAGAC -3'

Sequencing Primer
(F):5'- GTGGTCTCCCATCAGCTTC -3'
(R):5'- TGCATGTCACAGACACGGG -3'
Posted On 2015-11-11