Incidental Mutation 'R0403:Rasal3'
ID35741
Institutional Source Beutler Lab
Gene Symbol Rasal3
Ensembl Gene ENSMUSG00000052142
Gene NameRAS protein activator like 3
SynonymsA430107D22Rik
MMRRC Submission 038608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0403 (G1)
Quality Score105
Status Validated
Chromosome17
Chromosomal Location32390659-32403583 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 32392790 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000063824] [ENSMUST00000063824] [ENSMUST00000063824] [ENSMUST00000087703] [ENSMUST00000135618] [ENSMUST00000135618] [ENSMUST00000135618] [ENSMUST00000135618] [ENSMUST00000135618] [ENSMUST00000135618] [ENSMUST00000135618] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000136375] [ENSMUST00000136375] [ENSMUST00000136375] [ENSMUST00000137458] [ENSMUST00000137458] [ENSMUST00000137458] [ENSMUST00000137458] [ENSMUST00000163107] [ENSMUST00000165912] [ENSMUST00000169280] [ENSMUST00000170603] [ENSMUST00000170617] [ENSMUST00000171728]
Predicted Effect probably null
Transcript: ENSMUST00000063824
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000063824
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000063824
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000063824
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087699
Predicted Effect probably null
Transcript: ENSMUST00000087703
SMART Domains Protein: ENSMUSP00000084993
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 531 553 1.67e-2 SMART
low complexity region 575 587 N/A INTRINSIC
low complexity region 606 622 N/A INTRINSIC
ZnF_C2H2 701 723 1.41e0 SMART
low complexity region 783 792 N/A INTRINSIC
low complexity region 868 886 N/A INTRINSIC
ZnF_C2H2 900 926 1.06e2 SMART
low complexity region 935 955 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134723
Predicted Effect probably null
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135618
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135968
Predicted Effect probably benign
Transcript: ENSMUST00000136375
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136375
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136375
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136375
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137458
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137458
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137458
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137458
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143808
Predicted Effect probably benign
Transcript: ENSMUST00000163107
SMART Domains Protein: ENSMUSP00000127943
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165912
SMART Domains Protein: ENSMUSP00000127651
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169280
SMART Domains Protein: ENSMUSP00000129700
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170603
SMART Domains Protein: ENSMUSP00000128241
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170617
SMART Domains Protein: ENSMUSP00000130517
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171728
SMART Domains Protein: ENSMUSP00000130054
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172216
Meta Mutation Damage Score 0.9583 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 probably null Het
Adgrg3 C T 8: 95,036,922 L284F probably benign Het
Alkbh8 T A 9: 3,385,469 V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 M590K probably benign Het
Arhgap15 C T 2: 44,063,766 T168I probably damaging Het
Arntl2 T A 6: 146,822,655 H348Q probably damaging Het
Atp8b1 A G 18: 64,540,310 V997A probably damaging Het
Atrn G A 2: 130,906,859 C100Y probably damaging Het
Baiap2l2 C A 15: 79,271,216 A151S probably benign Het
Baz2b A T 2: 59,969,377 D199E possibly damaging Het
Cblb A G 16: 52,152,626 D440G probably benign Het
Cdon T C 9: 35,473,500 V694A probably benign Het
Cep250 A T 2: 155,992,349 R2065W probably damaging Het
Ces2b G T 8: 104,833,945 A131S probably damaging Het
Chrna9 A T 5: 65,967,892 T59S possibly damaging Het
Cog3 T A 14: 75,742,327 probably benign Het
Cpa1 G A 6: 30,641,857 V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 probably null Het
Ddx60 A G 8: 61,994,541 probably benign Het
Dhx16 T C 17: 35,883,050 probably null Het
Dnah9 T A 11: 66,084,789 Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 D325V probably damaging Het
Entpd6 C A 2: 150,760,170 T194K possibly damaging Het
Fam208b A T 13: 3,582,052 Y816* probably null Het
Fat2 A T 11: 55,270,349 V3185E probably benign Het
Flrt1 A G 19: 7,095,919 L421P probably benign Het
Fmn2 A T 1: 174,694,278 Q1292L probably damaging Het
Fndc1 T C 17: 7,775,588 probably null Het
Fndc1 T C 17: 7,753,723 D1459G probably damaging Het
Fzr1 A G 10: 81,369,368 S265P possibly damaging Het
Gm13119 A G 4: 144,362,646 N178S probably benign Het
Gm14085 T C 2: 122,521,854 L364S probably damaging Het
Gpr142 G A 11: 114,806,029 V134M probably damaging Het
Grid2ip G T 5: 143,357,620 V24L possibly damaging Het
Herc2 G A 7: 56,159,417 R2555H probably damaging Het
Hpdl A T 4: 116,820,479 Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 I186V probably benign Het
Itga2b C T 11: 102,467,326 probably null Het
Itgae A C 11: 73,123,183 D736A possibly damaging Het
Itpkc T A 7: 27,208,345 M645L probably benign Het
Jchain T C 5: 88,521,378 R139G probably benign Het
Kif13a A G 13: 46,791,401 V908A probably damaging Het
Kif1b T A 4: 149,181,967 K389* probably null Het
Klhl12 T C 1: 134,485,856 Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 R148W probably damaging Het
Lpar1 T A 4: 58,487,191 N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Lum G T 10: 97,572,043 V337F probably benign Het
Mag T C 7: 30,906,980 D344G probably damaging Het
Maip1 G A 1: 57,407,196 A142T probably benign Het
Mlh3 A G 12: 85,268,968 V148A possibly damaging Het
Nav3 A G 10: 109,767,103 V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 S868P possibly damaging Het
Nek1 A G 8: 61,106,855 E907G probably damaging Het
Nfam1 G A 15: 83,016,379 T134I probably benign Het
Nr0b2 T C 4: 133,553,759 V112A probably damaging Het
Nrp1 A G 8: 128,457,969 N365S probably damaging Het
Nrsn2 T C 2: 152,369,790 Y107C probably damaging Het
Ntng1 G A 3: 109,934,611 A282V probably damaging Het
Nxf1 T C 19: 8,765,028 I337T probably damaging Het
Obscn C T 11: 59,076,540 G479D probably damaging Het
Olfr45 T C 7: 140,691,309 S135P possibly damaging Het
Oprd1 T A 4: 132,113,768 D293V probably benign Het
P3h2 T G 16: 25,969,950 N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Ppic C A 18: 53,411,071 G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 S46A probably benign Het
Prkce A G 17: 86,168,653 T21A probably damaging Het
Prkg2 T C 5: 98,994,645 E210G possibly damaging Het
Prss35 A G 9: 86,756,037 M287V probably damaging Het
Psd G A 19: 46,320,972 probably benign Het
Ptch2 A T 4: 117,110,839 K843* probably null Het
Rab44 C A 17: 29,145,261 T603K probably damaging Het
Rbbp6 A G 7: 122,992,296 T526A probably damaging Het
Ros1 A T 10: 52,143,438 probably benign Het
Sec24b T A 3: 129,989,676 L1104F possibly damaging Het
Sec24b A G 3: 129,999,534 S685P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setmar A T 6: 108,075,962 H139L probably benign Het
Slc4a7 T C 14: 14,766,808 V710A probably benign Het
Smarcc1 T A 9: 110,237,808 probably null Het
Smchd1 G A 17: 71,394,902 L1032F probably damaging Het
Speg T C 1: 75,430,784 probably benign Het
Tcea1 C G 1: 4,889,503 R134G probably benign Het
Tchhl1 C T 3: 93,471,029 Q347* probably null Het
Tecrl A T 5: 83,354,758 probably benign Het
Tepsin T C 11: 120,093,682 probably benign Het
Tmem40 G A 6: 115,733,985 probably benign Het
Tpr G A 1: 150,407,414 probably benign Het
Ttll12 A T 15: 83,580,658 probably benign Het
Ttn T A 2: 76,909,608 D3529V probably benign Het
Usp34 T A 11: 23,333,838 H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 S327T probably benign Het
Zbtb4 T A 11: 69,777,639 M396K probably damaging Het
Zfp352 C T 4: 90,225,009 T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 M145V probably damaging Het
Zfp780b C A 7: 27,971,689 V65F possibly damaging Het
Other mutations in Rasal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Rasal3 APN 17 32397405 missense possibly damaging 0.89
IGL02291:Rasal3 APN 17 32393737 unclassified probably benign
IGL02346:Rasal3 APN 17 32399349 missense probably damaging 1.00
IGL02422:Rasal3 APN 17 32398973 missense probably benign 0.11
Beaten UTSW 17 32391344 missense probably benign 0.05
bent UTSW 17 32396781 missense probably damaging 1.00
bowed UTSW 17 32396790 missense probably damaging 1.00
kinked UTSW 17 32396350 nonsense probably null
R0057:Rasal3 UTSW 17 32391383 missense probably benign 0.00
R0133:Rasal3 UTSW 17 32403383 start codon destroyed probably null 0.89
R0180:Rasal3 UTSW 17 32399405 missense probably benign
R0452:Rasal3 UTSW 17 32395817 splice site probably benign
R0600:Rasal3 UTSW 17 32393526 missense probably damaging 0.99
R0760:Rasal3 UTSW 17 32392172 missense probably benign 0.00
R1438:Rasal3 UTSW 17 32393535 unclassified probably null
R1669:Rasal3 UTSW 17 32403098 missense possibly damaging 0.81
R1914:Rasal3 UTSW 17 32396350 nonsense probably null
R1928:Rasal3 UTSW 17 32397353 missense probably damaging 1.00
R2002:Rasal3 UTSW 17 32393611 missense probably damaging 1.00
R3053:Rasal3 UTSW 17 32403439 missense probably benign 0.03
R3770:Rasal3 UTSW 17 32392151 missense probably damaging 0.99
R3870:Rasal3 UTSW 17 32393548 missense possibly damaging 0.94
R4491:Rasal3 UTSW 17 32391385 missense probably damaging 0.99
R4783:Rasal3 UTSW 17 32396781 missense probably damaging 1.00
R4788:Rasal3 UTSW 17 32399338 missense probably benign 0.00
R4903:Rasal3 UTSW 17 32397383 missense probably damaging 1.00
R5185:Rasal3 UTSW 17 32396790 missense probably damaging 1.00
R5372:Rasal3 UTSW 17 32391344 missense probably benign 0.05
R5433:Rasal3 UTSW 17 32393601 missense probably benign 0.00
R5472:Rasal3 UTSW 17 32396669 missense probably damaging 1.00
R5920:Rasal3 UTSW 17 32395169 missense probably damaging 1.00
R6436:Rasal3 UTSW 17 32397504 missense probably damaging 1.00
R6837:Rasal3 UTSW 17 32403070 missense probably benign 0.17
R7047:Rasal3 UTSW 17 32396484 missense probably damaging 1.00
R7109:Rasal3 UTSW 17 32392709 missense probably damaging 1.00
R7179:Rasal3 UTSW 17 32392417 missense probably damaging 0.99
R7571:Rasal3 UTSW 17 32395861 missense possibly damaging 0.76
R7768:Rasal3 UTSW 17 32396793 missense probably damaging 0.96
R7874:Rasal3 UTSW 17 32396707 missense possibly damaging 0.75
R7957:Rasal3 UTSW 17 32396707 missense possibly damaging 0.75
RF004:Rasal3 UTSW 17 32391107 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32391219 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32392526 missense probably benign 0.00
X0065:Rasal3 UTSW 17 32403286 missense probably damaging 1.00
Z1177:Rasal3 UTSW 17 32399310 missense not run
Predicted Primers PCR Primer
(F):5'- CTTGTAGGTCGGGGAAAATGTCTCAG -3'
(R):5'- AAAAGTGGTTACCCTTGTGAGCAGAG -3'

Sequencing Primer
(F):5'- CTCAGAGTTAGATGAGCCTAAGATCC -3'
(R):5'- TCGGACCAAGGTCAGAAGTC -3'
Posted On2013-05-09