Mutagenetix > Incidental Mutation

Incidental Mutation 'R4749:Grid1'

357427

Institutional Source

Beutler Lab

Gene Symbol

Grid1

Ensembl Gene

ENSMUSG00000041078

Gene Name

glutamate receptor, ionotropic, delta 1

Synonyms

GluRdelta1

MMRRC Submission

041969-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R4749 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

34820108-35583379 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 35580687 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 970 (S970T)

Ref Sequence

ENSEMBL: ENSMUSP00000044009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043349]

AlphaFold

Q61627

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043349
AA Change: S970T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: S970T

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	36	400	4.1e-51	PFAM
PBPe	438	807	4.68e-110	SMART
Lig_chan-Glu_bd	448	510	8.18e-25	SMART
low complexity region	838	853	N/A	INTRINSIC
low complexity region	943	958	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173307

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	T	19: 57,215,721	D79E	probably benign	Het
Adgra2	A	G	8: 27,114,197	K472E	probably damaging	Het
Akap9	A	G	5: 3,968,737	D1106G	probably benign	Het
Arhgap35	T	C	7: 16,498,626	E1367G	possibly damaging	Het
Arsi	A	T	18: 60,917,461	Y472F	probably benign	Het
Asxl3	A	G	18: 22,516,769	D605G	probably damaging	Het
Atp6v1e2	C	T	17: 86,944,707	D88N	probably benign	Het
BC061237	T	A	14: 44,506,012	V169E	probably damaging	Het
C1galt1	A	G	6: 7,866,379	E75G	probably benign	Het
C530008M17Rik	T	C	5: 76,858,834	V1014A	unknown	Het
C9	G	A	15: 6,489,830	V383I	probably benign	Het
Ccdc88a	A	G	11: 29,482,720	K222R	probably benign	Het
Ccna2	T	C	3: 36,566,242	S421G	probably benign	Het
Cflar	T	G	1: 58,740,272	V229G	possibly damaging	Het
Clcn1	A	G	6: 42,290,197		probably null	Het
Col14a1	T	A	15: 55,452,336	F1342L	unknown	Het
Colq	C	T	14: 31,529,515	R313H	possibly damaging	Het
Coro6	A	G	11: 77,469,148	E345G	probably damaging	Het
Cyb561	A	G	11: 105,935,882	F182L	probably benign	Het
Dap3	A	G	3: 88,926,310	S317P	probably benign	Het
Dnah9	G	A	11: 65,834,115	A4404V	probably damaging	Het
Dsg4	A	G	18: 20,446,831	E31G	possibly damaging	Het
Dsn1	G	A	2: 157,001,740	L147F	probably damaging	Het
Dysf	T	C	6: 84,067,008	V277A	probably damaging	Het
Eprs	T	A	1: 185,396,130	I569K	probably damaging	Het
Erg	T	C	16: 95,361,170	N342S	probably damaging	Het
Fam114a1	G	A	5: 65,009,066	D247N	probably damaging	Het
Fat2	A	G	11: 55,311,468	V260A	probably benign	Het
Foxn4	T	C	5: 114,255,567	D497G	probably damaging	Het
Fsip2	A	G	2: 82,989,285	I5121V	probably benign	Het
Gcn1l1	T	A	5: 115,614,402	D2155E	probably benign	Het
Glra1	C	A	11: 55,536,384	D42Y	probably damaging	Het
Gpr171	A	G	3: 59,097,466	V296A	probably benign	Het
Hcn3	A	T	3: 89,150,063		probably null	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Hsd3b3	G	A	3: 98,742,615	P131S	probably damaging	Het
Hsp90b1	A	G	10: 86,701,808	V211A	probably damaging	Het
Htr2c	A	G	X: 147,193,797	T163A	probably benign	Het
Ifi208	T	A	1: 173,695,614	D483E	possibly damaging	Het
Kbtbd6	T	A	14: 79,453,287	V474E	possibly damaging	Het
Kif21b	T	A	1: 136,144,749	Y64*	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Map3k10	T	C	7: 27,658,361	D664G	possibly damaging	Het
Map3k5	C	A	10: 20,132,052	S1201Y	probably benign	Het
Mcm2	T	C	6: 88,891,991	E293G	possibly damaging	Het
Med21	T	A	6: 146,650,101		probably null	Het
Mettl18	T	C	1: 163,996,785	V225A	probably benign	Het
Mmp10	A	T	9: 7,508,168	I432F	probably damaging	Het
Muc5b	T	G	7: 141,861,448	Y2710*	probably null	Het
Neurl4	A	T	11: 69,911,068	I1282F	probably benign	Het
Nipbl	A	T	15: 8,365,829	H191Q	possibly damaging	Het
Nktr	A	G	9: 121,741,693	D167G	probably damaging	Het
Nrap	A	G	19: 56,380,237	I249T	probably damaging	Het
Nsfl1c	A	G	2: 151,509,606	T297A	probably benign	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr1449	C	T	19: 12,935,217	H160Y	probably benign	Het
Olfr20	G	A	11: 73,354,496	V248M	probably damaging	Het
Olfr731	A	G	14: 50,238,733	S51P	probably damaging	Het
Pcnx2	T	C	8: 125,887,588	S375G	probably damaging	Het
Phf2	A	T	13: 48,821,709		probably null	Het
Piezo1	G	T	8: 122,498,206	Q654K	probably damaging	Het
Piezo1	A	T	8: 122,486,939	M1739K	possibly damaging	Het
Pml	C	T	9: 58,234,652	R299H	probably damaging	Het
Ppp3cb	A	T	14: 20,524,062	M236K	probably damaging	Het
Prkch	T	A	12: 73,692,960	C203S	probably damaging	Het
Prob1	C	T	18: 35,652,816	R795H	possibly damaging	Het
Prr22	G	C	17: 56,771,274	E142D	possibly damaging	Het
Prss56	C	A	1: 87,185,583	A211E	possibly damaging	Het
Qser1	A	C	2: 104,787,304	S1054R	probably benign	Het
Rhbdl2	T	C	4: 123,826,901		probably null	Het
Rhot2	C	A	17: 25,844,274	G19V	probably damaging	Het
Rp1l1	C	T	14: 64,029,800	T945M	probably damaging	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Sdad1	C	T	5: 92,304,977	R134Q	possibly damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Sharpin	T	A	15: 76,347,567	D314V	probably damaging	Het
Slc14a2	A	T	18: 78,155,581	L778Q	probably damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc4a11	C	A	2: 130,690,867	R222L	probably damaging	Het
Slc7a10	C	T	7: 35,200,762	P502S	probably damaging	Het
Sort1	T	G	3: 108,356,323	Y812*	probably null	Het
Spata31d1b	G	A	13: 59,718,358	V1107M	probably damaging	Het
Tcp10b	G	A	17: 13,070,945		probably null	Het
Tmem8	T	C	17: 26,116,783	F48S	probably damaging	Het
Tnc	T	C	4: 63,995,639	D1312G	possibly damaging	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Topors	A	T	4: 40,261,015	S756R	unknown	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Ube2o	T	C	11: 116,541,908	D744G	probably benign	Het
Vmn1r224	A	G	17: 20,419,751	I197V	probably benign	Het
Zc3h18	A	T	8: 122,383,643	D77V	probably damaging	Het

Other mutations in Grid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Grid1	APN	14	35445887	missense	possibly damaging	0.70
IGL01016:Grid1	APN	14	34822639	nonsense	probably null
IGL01643:Grid1	APN	14	35323435	critical splice donor site	probably null
IGL01697:Grid1	APN	14	35309257	missense	probably benign	0.21
IGL01879:Grid1	APN	14	35450370	missense	possibly damaging	0.93
IGL01975:Grid1	APN	14	35323426	missense	probably benign
IGL02515:Grid1	APN	14	35452345	missense	probably damaging	0.99
IGL02935:Grid1	APN	14	34822558	missense	possibly damaging	0.86
IGL03279:Grid1	APN	14	34945765	missense	probably damaging	0.98
IGL03286:Grid1	APN	14	35520685	splice site	probably benign
IGL03296:Grid1	APN	14	35580567	missense	possibly damaging	0.52
IGL03305:Grid1	APN	14	35251707	missense	probably damaging	1.00
R0533:Grid1	UTSW	14	35309385	missense	possibly damaging	0.84
R0746:Grid1	UTSW	14	34822690	missense	possibly damaging	0.92
R0811:Grid1	UTSW	14	34822619	missense	probably benign
R0812:Grid1	UTSW	14	34822619	missense	probably benign
R1144:Grid1	UTSW	14	35562676	splice site	probably benign
R1217:Grid1	UTSW	14	34820229	start codon destroyed	probably null	0.53
R1485:Grid1	UTSW	14	34822583	missense	probably damaging	1.00
R1529:Grid1	UTSW	14	35309293	missense	probably benign	0.36
R1606:Grid1	UTSW	14	35445965	missense	probably damaging	0.96
R1691:Grid1	UTSW	14	35452329	missense	probably damaging	1.00
R1759:Grid1	UTSW	14	35446031	missense	possibly damaging	0.92
R2374:Grid1	UTSW	14	35321807	splice site	probably benign
R2415:Grid1	UTSW	14	35450369	missense	possibly damaging	0.69
R2866:Grid1	UTSW	14	35562559	missense	probably damaging	1.00
R3915:Grid1	UTSW	14	35520727	missense	probably damaging	1.00
R4044:Grid1	UTSW	14	35450401	splice site	probably benign
R4364:Grid1	UTSW	14	34946032	missense	probably benign	0.20
R4691:Grid1	UTSW	14	35569557	missense	probably benign
R4694:Grid1	UTSW	14	35026780	missense	probably damaging	1.00
R4794:Grid1	UTSW	14	34822622	missense	probably damaging	0.99
R4854:Grid1	UTSW	14	35321641	missense	probably benign
R5555:Grid1	UTSW	14	35520705	missense	possibly damaging	0.92
R6005:Grid1	UTSW	14	35323412	missense	probably damaging	1.00
R6176:Grid1	UTSW	14	35562547	missense	probably benign	0.00
R6569:Grid1	UTSW	14	35323339	missense	possibly damaging	0.72
R6911:Grid1	UTSW	14	34820228	start codon destroyed	probably benign	0.08
R7504:Grid1	UTSW	14	35562513	missense	probably damaging	1.00
R7744:Grid1	UTSW	14	35450079	missense	probably damaging	1.00
R7795:Grid1	UTSW	14	35321685	missense	probably damaging	1.00
R7883:Grid1	UTSW	14	35450302	splice site	probably null
R7913:Grid1	UTSW	14	35569697	missense	probably damaging	0.99
R8032:Grid1	UTSW	14	35323359	missense	probably benign	0.00
R8333:Grid1	UTSW	14	35569638	missense	possibly damaging	0.82
R8916:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8928:Grid1	UTSW	14	35580766	missense	probably benign	0.25
R8934:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8935:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8939:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8986:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8993:Grid1	UTSW	14	35026942	missense	probably benign	0.00
R9238:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9310:Grid1	UTSW	14	35026805	missense	probably damaging	1.00
R9332:Grid1	UTSW	14	35323403	missense	probably benign	0.06
R9335:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9336:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9478:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9479:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9496:Grid1	UTSW	14	35569614	missense	probably damaging	1.00
R9583:Grid1	UTSW	14	35580535	missense	possibly damaging	0.90
R9601:Grid1	UTSW	14	35445857	missense	probably damaging	0.99
R9734:Grid1	UTSW	14	35580785	missense	probably benign
U24488:Grid1	UTSW	14	35580577	missense	probably benign	0.00
Z1088:Grid1	UTSW	14	35452294	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGCGTCCATTGAGCTTTC -3'
(R):5'- GCTCCTTTGGCACTTCAGAATG -3'

Sequencing Primer
(F):5'- CATTGAGCTTTCTGCCCTAGAGATG -3'
(R):5'- ATTAAAAAGCTCTGCTGGTCGG -3'

Posted On

2015-11-11