Incidental Mutation 'R4749:Dsg4'
ID 357443
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 041969-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R4749 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20579888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 31 (E31G)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect possibly damaging
Transcript: ENSMUST00000019426
AA Change: E31G

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: E31G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,204,153 (GRCm39) D79E probably benign Het
Adgra2 A G 8: 27,604,225 (GRCm39) K472E probably damaging Het
Akap9 A G 5: 4,018,737 (GRCm39) D1106G probably benign Het
Arhgap35 T C 7: 16,232,551 (GRCm39) E1367G possibly damaging Het
Arsi A T 18: 61,050,533 (GRCm39) Y472F probably benign Het
Asxl3 A G 18: 22,649,826 (GRCm39) D605G probably damaging Het
Atp6v1e2 C T 17: 87,252,135 (GRCm39) D88N probably benign Het
BC061237 T A 14: 44,743,469 (GRCm39) V169E probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
C9 G A 15: 6,519,311 (GRCm39) V383I probably benign Het
Ccdc88a A G 11: 29,432,720 (GRCm39) K222R probably benign Het
Ccna2 T C 3: 36,620,391 (GRCm39) S421G probably benign Het
Cflar T G 1: 58,779,431 (GRCm39) V229G possibly damaging Het
Clcn1 A G 6: 42,267,131 (GRCm39) probably null Het
Col14a1 T A 15: 55,315,732 (GRCm39) F1342L unknown Het
Colq C T 14: 31,251,472 (GRCm39) R313H possibly damaging Het
Coro6 A G 11: 77,359,974 (GRCm39) E345G probably damaging Het
Cracd T C 5: 77,006,681 (GRCm39) V1014A unknown Het
Cyb561 A G 11: 105,826,708 (GRCm39) F182L probably benign Het
Dap3 A G 3: 88,833,617 (GRCm39) S317P probably benign Het
Dnah9 G A 11: 65,724,941 (GRCm39) A4404V probably damaging Het
Dsn1 G A 2: 156,843,660 (GRCm39) L147F probably damaging Het
Dysf T C 6: 84,043,990 (GRCm39) V277A probably damaging Het
Eprs1 T A 1: 185,128,327 (GRCm39) I569K probably damaging Het
Erg T C 16: 95,162,029 (GRCm39) N342S probably damaging Het
Fam114a1 G A 5: 65,166,409 (GRCm39) D247N probably damaging Het
Fat2 A G 11: 55,202,294 (GRCm39) V260A probably benign Het
Foxn4 T C 5: 114,393,628 (GRCm39) D497G probably damaging Het
Fsip2 A G 2: 82,819,629 (GRCm39) I5121V probably benign Het
Gcn1 T A 5: 115,752,461 (GRCm39) D2155E probably benign Het
Glra1 C A 11: 55,427,210 (GRCm39) D42Y probably damaging Het
Gpr171 A G 3: 59,004,887 (GRCm39) V296A probably benign Het
Grid1 T A 14: 35,302,644 (GRCm39) S970T possibly damaging Het
Hcn3 A T 3: 89,057,370 (GRCm39) probably null Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Hsd3b3 G A 3: 98,649,931 (GRCm39) P131S probably damaging Het
Hsp90b1 A G 10: 86,537,672 (GRCm39) V211A probably damaging Het
Htr2c A G X: 145,976,793 (GRCm39) T163A probably benign Het
Ifi208 T A 1: 173,523,180 (GRCm39) D483E possibly damaging Het
Kbtbd6 T A 14: 79,690,727 (GRCm39) V474E possibly damaging Het
Kif21b T A 1: 136,072,487 (GRCm39) Y64* probably null Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Map3k10 T C 7: 27,357,786 (GRCm39) D664G possibly damaging Het
Map3k5 C A 10: 20,007,798 (GRCm39) S1201Y probably benign Het
Mcm2 T C 6: 88,868,973 (GRCm39) E293G possibly damaging Het
Med21 T A 6: 146,551,599 (GRCm39) probably null Het
Mettl18 T C 1: 163,824,354 (GRCm39) V225A probably benign Het
Mmp10 A T 9: 7,508,169 (GRCm39) I432F probably damaging Het
Muc5b T G 7: 141,415,185 (GRCm39) Y2710* probably null Het
Neurl4 A T 11: 69,801,894 (GRCm39) I1282F probably benign Het
Nipbl A T 15: 8,395,313 (GRCm39) H191Q possibly damaging Het
Nktr A G 9: 121,570,759 (GRCm39) D167G probably damaging Het
Nrap A G 19: 56,368,669 (GRCm39) I249T probably damaging Het
Nsfl1c A G 2: 151,351,526 (GRCm39) T297A probably benign Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Or1e1 G A 11: 73,245,322 (GRCm39) V248M probably damaging Het
Or4a39 C T 2: 89,236,599 (GRCm39) V275I probably benign Het
Or4k6 A G 14: 50,476,190 (GRCm39) S51P probably damaging Het
Or5b24 C T 19: 12,912,581 (GRCm39) H160Y probably benign Het
Or5d36 T A 2: 87,900,956 (GRCm39) I257L probably benign Het
Pcnx2 T C 8: 126,614,327 (GRCm39) S375G probably damaging Het
Pgap6 T C 17: 26,335,757 (GRCm39) F48S probably damaging Het
Phf2 A T 13: 48,975,185 (GRCm39) probably null Het
Piezo1 A T 8: 123,213,678 (GRCm39) M1739K possibly damaging Het
Piezo1 G T 8: 123,224,945 (GRCm39) Q654K probably damaging Het
Pml C T 9: 58,141,935 (GRCm39) R299H probably damaging Het
Ppp3cb A T 14: 20,574,130 (GRCm39) M236K probably damaging Het
Prkch T A 12: 73,739,734 (GRCm39) C203S probably damaging Het
Prob1 C T 18: 35,785,869 (GRCm39) R795H possibly damaging Het
Prr22 G C 17: 57,078,274 (GRCm39) E142D possibly damaging Het
Prss56 C A 1: 87,113,305 (GRCm39) A211E possibly damaging Het
Qser1 A C 2: 104,617,649 (GRCm39) S1054R probably benign Het
Rhbdl2 T C 4: 123,720,694 (GRCm39) probably null Het
Rhot2 C A 17: 26,063,248 (GRCm39) G19V probably damaging Het
Rp1l1 C T 14: 64,267,249 (GRCm39) T945M probably damaging Het
Ryr3 T C 2: 112,794,750 (GRCm39) T121A possibly damaging Het
Sdad1 C T 5: 92,452,836 (GRCm39) R134Q possibly damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Sharpin T A 15: 76,231,767 (GRCm39) D314V probably damaging Het
Slc14a2 A T 18: 78,198,796 (GRCm39) L778Q probably damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc4a11 C A 2: 130,532,787 (GRCm39) R222L probably damaging Het
Slc7a10 C T 7: 34,900,187 (GRCm39) P502S probably damaging Het
Sort1 T G 3: 108,263,639 (GRCm39) Y812* probably null Het
Spata31d1b G A 13: 59,866,172 (GRCm39) V1107M probably damaging Het
Tcp10b G A 17: 13,289,832 (GRCm39) probably null Het
Tnc T C 4: 63,913,876 (GRCm39) D1312G possibly damaging Het
Tomm40l G A 1: 171,047,131 (GRCm39) R296* probably null Het
Topors A T 4: 40,261,015 (GRCm39) S756R unknown Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Ube2o T C 11: 116,432,734 (GRCm39) D744G probably benign Het
Vmn1r224 A G 17: 20,640,013 (GRCm39) I197V probably benign Het
Zc3h18 A T 8: 123,110,382 (GRCm39) D77V probably damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATCCCAACACAGTTAGGGGTG -3'
(R):5'- CTGAAGGCTGCAAGTCCTTG -3'

Sequencing Primer
(F):5'- GGAGAGGTTAAGTCTGTCCAG -3'
(R):5'- GAAGGCTGCAAGTCCTTGAGATATTC -3'
Posted On 2015-11-11