Mutagenetix > Incidental Mutation

Incidental Mutation 'R4749:Dsg4'

357443

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

MMRRC Submission

041969-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.762) question?

Stock #

R4749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20446831 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 31 (E31G)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

AlphaFold

Q7TMD7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019426
AA Change: E31G

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: E31G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	A	T	19: 57,215,721	D79E	probably benign	Het
Adgra2	A	G	8: 27,114,197	K472E	probably damaging	Het
Akap9	A	G	5: 3,968,737	D1106G	probably benign	Het
Arhgap35	T	C	7: 16,498,626	E1367G	possibly damaging	Het
Arsi	A	T	18: 60,917,461	Y472F	probably benign	Het
Asxl3	A	G	18: 22,516,769	D605G	probably damaging	Het
Atp6v1e2	C	T	17: 86,944,707	D88N	probably benign	Het
BC061237	T	A	14: 44,506,012	V169E	probably damaging	Het
C1galt1	A	G	6: 7,866,379	E75G	probably benign	Het
C530008M17Rik	T	C	5: 76,858,834	V1014A	unknown	Het
C9	G	A	15: 6,489,830	V383I	probably benign	Het
Ccdc88a	A	G	11: 29,482,720	K222R	probably benign	Het
Ccna2	T	C	3: 36,566,242	S421G	probably benign	Het
Cflar	T	G	1: 58,740,272	V229G	possibly damaging	Het
Clcn1	A	G	6: 42,290,197		probably null	Het
Col14a1	T	A	15: 55,452,336	F1342L	unknown	Het
Colq	C	T	14: 31,529,515	R313H	possibly damaging	Het
Coro6	A	G	11: 77,469,148	E345G	probably damaging	Het
Cyb561	A	G	11: 105,935,882	F182L	probably benign	Het
Dap3	A	G	3: 88,926,310	S317P	probably benign	Het
Dnah9	G	A	11: 65,834,115	A4404V	probably damaging	Het
Dsn1	G	A	2: 157,001,740	L147F	probably damaging	Het
Dysf	T	C	6: 84,067,008	V277A	probably damaging	Het
Eprs	T	A	1: 185,396,130	I569K	probably damaging	Het
Erg	T	C	16: 95,361,170	N342S	probably damaging	Het
Fam114a1	G	A	5: 65,009,066	D247N	probably damaging	Het
Fat2	A	G	11: 55,311,468	V260A	probably benign	Het
Foxn4	T	C	5: 114,255,567	D497G	probably damaging	Het
Fsip2	A	G	2: 82,989,285	I5121V	probably benign	Het
Gcn1l1	T	A	5: 115,614,402	D2155E	probably benign	Het
Glra1	C	A	11: 55,536,384	D42Y	probably damaging	Het
Gpr171	A	G	3: 59,097,466	V296A	probably benign	Het
Grid1	T	A	14: 35,580,687	S970T	possibly damaging	Het
Hcn3	A	T	3: 89,150,063		probably null	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Hsd3b3	G	A	3: 98,742,615	P131S	probably damaging	Het
Hsp90b1	A	G	10: 86,701,808	V211A	probably damaging	Het
Htr2c	A	G	X: 147,193,797	T163A	probably benign	Het
Ifi208	T	A	1: 173,695,614	D483E	possibly damaging	Het
Kbtbd6	T	A	14: 79,453,287	V474E	possibly damaging	Het
Kif21b	T	A	1: 136,144,749	Y64*	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Map3k10	T	C	7: 27,658,361	D664G	possibly damaging	Het
Map3k5	C	A	10: 20,132,052	S1201Y	probably benign	Het
Mcm2	T	C	6: 88,891,991	E293G	possibly damaging	Het
Med21	T	A	6: 146,650,101		probably null	Het
Mettl18	T	C	1: 163,996,785	V225A	probably benign	Het
Mmp10	A	T	9: 7,508,168	I432F	probably damaging	Het
Muc5b	T	G	7: 141,861,448	Y2710*	probably null	Het
Neurl4	A	T	11: 69,911,068	I1282F	probably benign	Het
Nipbl	A	T	15: 8,365,829	H191Q	possibly damaging	Het
Nktr	A	G	9: 121,741,693	D167G	probably damaging	Het
Nrap	A	G	19: 56,380,237	I249T	probably damaging	Het
Nsfl1c	A	G	2: 151,509,606	T297A	probably benign	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr1449	C	T	19: 12,935,217	H160Y	probably benign	Het
Olfr20	G	A	11: 73,354,496	V248M	probably damaging	Het
Olfr731	A	G	14: 50,238,733	S51P	probably damaging	Het
Pcnx2	T	C	8: 125,887,588	S375G	probably damaging	Het
Phf2	A	T	13: 48,821,709		probably null	Het
Piezo1	A	T	8: 122,486,939	M1739K	possibly damaging	Het
Piezo1	G	T	8: 122,498,206	Q654K	probably damaging	Het
Pml	C	T	9: 58,234,652	R299H	probably damaging	Het
Ppp3cb	A	T	14: 20,524,062	M236K	probably damaging	Het
Prkch	T	A	12: 73,692,960	C203S	probably damaging	Het
Prob1	C	T	18: 35,652,816	R795H	possibly damaging	Het
Prr22	G	C	17: 56,771,274	E142D	possibly damaging	Het
Prss56	C	A	1: 87,185,583	A211E	possibly damaging	Het
Qser1	A	C	2: 104,787,304	S1054R	probably benign	Het
Rhbdl2	T	C	4: 123,826,901		probably null	Het
Rhot2	C	A	17: 25,844,274	G19V	probably damaging	Het
Rp1l1	C	T	14: 64,029,800	T945M	probably damaging	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Sdad1	C	T	5: 92,304,977	R134Q	possibly damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Sharpin	T	A	15: 76,347,567	D314V	probably damaging	Het
Slc14a2	A	T	18: 78,155,581	L778Q	probably damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc4a11	C	A	2: 130,690,867	R222L	probably damaging	Het
Slc7a10	C	T	7: 35,200,762	P502S	probably damaging	Het
Sort1	T	G	3: 108,356,323	Y812*	probably null	Het
Spata31d1b	G	A	13: 59,718,358	V1107M	probably damaging	Het
Tcp10b	G	A	17: 13,070,945		probably null	Het
Tmem8	T	C	17: 26,116,783	F48S	probably damaging	Het
Tnc	T	C	4: 63,995,639	D1312G	possibly damaging	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Topors	A	T	4: 40,261,015	S756R	unknown	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Ube2o	T	C	11: 116,541,908	D744G	probably benign	Het
Vmn1r224	A	G	17: 20,419,751	I197V	probably benign	Het
Zc3h18	A	T	8: 122,383,643	D77V	probably damaging	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
woodshed	UTSW	18	20451872	nonsense	probably null
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1442:Dsg4	UTSW	18	20462660	missense	possibly damaging	0.76
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R1982:Dsg4	UTSW	18	20471212	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4012:Dsg4	UTSW	18	20451862	missense	possibly damaging	0.81
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5426:Dsg4	UTSW	18	20458484	missense	probably damaging	1.00
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R5982:Dsg4	UTSW	18	20465169	missense	possibly damaging	0.76
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7040:Dsg4	UTSW	18	20451852	missense	probably benign	0.01
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7432:Dsg4	UTSW	18	20446266	nonsense	probably null
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null
R9059:Dsg4	UTSW	18	20471125	missense	possibly damaging	0.62
R9508:Dsg4	UTSW	18	20471013	missense	probably damaging	1.00
R9607:Dsg4	UTSW	18	20452990	missense	probably benign	0.00
R9765:Dsg4	UTSW	18	20471277	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CATCCCAACACAGTTAGGGGTG -3'
(R):5'- CTGAAGGCTGCAAGTCCTTG -3'

Sequencing Primer
(F):5'- GGAGAGGTTAAGTCTGTCCAG -3'
(R):5'- GAAGGCTGCAAGTCCTTGAGATATTC -3'

Posted On

2015-11-11