Incidental Mutation 'R4750:Zfp142'
ID357455
Institutional Source Beutler Lab
Gene Symbol Zfp142
Ensembl Gene ENSMUSG00000026135
Gene Namezinc finger protein 142
Synonyms9330177B18Rik
MMRRC Submission 042031-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4750 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74565127-74588246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74572458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 623 (E623G)
Ref Sequence ENSEMBL: ENSMUSP00000109366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027315] [ENSMUST00000066986] [ENSMUST00000067916] [ENSMUST00000113737] [ENSMUST00000113749] [ENSMUST00000127921] [ENSMUST00000141412] [ENSMUST00000156613]
Predicted Effect probably damaging
Transcript: ENSMUST00000027315
AA Change: E726G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027315
Gene: ENSMUSG00000026135
AA Change: E726G

DomainStartEndE-ValueType
ZnF_C2H2 103 127 1.16e1 SMART
ZnF_C2H2 164 186 1.26e-2 SMART
ZnF_C2H2 193 218 7.78e-3 SMART
ZnF_C2H2 223 247 2.29e0 SMART
ZnF_C2H2 250 272 9.96e-1 SMART
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 363 385 9.96e-1 SMART
ZnF_C2H2 391 411 1.26e1 SMART
ZnF_C2H2 419 442 1.47e-3 SMART
ZnF_C2H2 453 475 2.75e-3 SMART
ZnF_C2H2 486 511 3.34e-2 SMART
ZnF_C2H2 516 540 4.81e0 SMART
ZnF_C2H2 543 566 7.05e-1 SMART
ZnF_C2H2 572 595 2.17e-1 SMART
ZnF_C2H2 601 623 1.56e-2 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 657 679 1.38e-3 SMART
ZnF_C2H2 685 707 9.44e-2 SMART
ZnF_C2H2 712 735 1.26e-2 SMART
ZnF_C2H2 744 767 1.31e0 SMART
ZnF_C2H2 773 796 2.63e0 SMART
low complexity region 903 919 N/A INTRINSIC
low complexity region 953 969 N/A INTRINSIC
low complexity region 996 1007 N/A INTRINSIC
ZnF_C2H2 1039 1059 2.01e1 SMART
ZnF_C2H2 1069 1089 1.91e1 SMART
low complexity region 1147 1160 N/A INTRINSIC
ZnF_C2H2 1187 1207 2.7e2 SMART
low complexity region 1209 1222 N/A INTRINSIC
ZnF_C2H2 1265 1285 3.56e1 SMART
ZnF_C2H2 1295 1318 4.98e-1 SMART
ZnF_C2H2 1331 1354 2.49e-1 SMART
ZnF_C2H2 1360 1382 1.03e-2 SMART
ZnF_C2H2 1388 1411 5.72e-1 SMART
ZnF_C2H2 1417 1440 6.75e0 SMART
ZnF_C2H2 1446 1469 9.58e-3 SMART
ZnF_C2H2 1488 1511 1.64e-1 SMART
ZnF_C2H2 1514 1536 1.1e-2 SMART
ZnF_C2H2 1540 1563 4.05e-1 SMART
ZnF_C2H2 1580 1602 4.45e0 SMART
ZnF_C2H2 1608 1630 8.81e-2 SMART
ZnF_C2H2 1636 1658 1.18e-2 SMART
ZnF_C2H2 1664 1686 1.2e-3 SMART
ZnF_C2H2 1692 1715 3.89e-3 SMART
ZnF_C2H2 1721 1743 4.54e-4 SMART
ZnF_C2H2 1749 1771 1.18e-2 SMART
ZnF_C2H2 1777 1799 3.52e-1 SMART
low complexity region 1829 1838 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066986
AA Change: E525G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065149
Gene: ENSMUSG00000026135
AA Change: E525G

DomainStartEndE-ValueType
low complexity region 116 128 N/A INTRINSIC
ZnF_C2H2 162 184 9.96e-1 SMART
ZnF_C2H2 190 210 1.26e1 SMART
ZnF_C2H2 218 241 1.47e-3 SMART
ZnF_C2H2 252 274 2.75e-3 SMART
ZnF_C2H2 285 310 3.34e-2 SMART
ZnF_C2H2 315 339 4.81e0 SMART
ZnF_C2H2 342 365 7.05e-1 SMART
ZnF_C2H2 371 394 2.17e-1 SMART
ZnF_C2H2 400 422 1.56e-2 SMART
ZnF_C2H2 428 450 8.94e-3 SMART
ZnF_C2H2 456 478 1.38e-3 SMART
ZnF_C2H2 484 506 9.44e-2 SMART
ZnF_C2H2 511 534 1.26e-2 SMART
ZnF_C2H2 543 566 1.31e0 SMART
ZnF_C2H2 572 595 2.63e0 SMART
low complexity region 702 718 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
ZnF_C2H2 838 858 2.01e1 SMART
ZnF_C2H2 868 888 1.91e1 SMART
low complexity region 946 959 N/A INTRINSIC
ZnF_C2H2 986 1006 2.7e2 SMART
low complexity region 1008 1021 N/A INTRINSIC
ZnF_C2H2 1064 1084 3.56e1 SMART
ZnF_C2H2 1094 1117 4.98e-1 SMART
ZnF_C2H2 1130 1153 2.49e-1 SMART
ZnF_C2H2 1159 1181 1.03e-2 SMART
ZnF_C2H2 1187 1210 5.72e-1 SMART
ZnF_C2H2 1216 1239 6.75e0 SMART
ZnF_C2H2 1245 1268 9.58e-3 SMART
ZnF_C2H2 1287 1310 1.64e-1 SMART
ZnF_C2H2 1313 1335 1.1e-2 SMART
ZnF_C2H2 1339 1362 4.05e-1 SMART
ZnF_C2H2 1379 1401 4.45e0 SMART
ZnF_C2H2 1407 1429 8.81e-2 SMART
ZnF_C2H2 1435 1457 1.18e-2 SMART
ZnF_C2H2 1463 1485 1.2e-3 SMART
ZnF_C2H2 1491 1514 3.89e-3 SMART
ZnF_C2H2 1520 1542 4.54e-4 SMART
ZnF_C2H2 1548 1570 1.18e-2 SMART
ZnF_C2H2 1576 1598 3.52e-1 SMART
low complexity region 1628 1637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067916
SMART Domains Protein: ENSMUSP00000064413
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113737
AA Change: E623G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109366
Gene: ENSMUSG00000026135
AA Change: E623G

DomainStartEndE-ValueType
ZnF_C2H2 93 115 9.81e1 SMART
ZnF_C2H2 120 144 2.29e0 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
low complexity region 214 226 N/A INTRINSIC
ZnF_C2H2 260 282 9.96e-1 SMART
ZnF_C2H2 288 308 1.26e1 SMART
ZnF_C2H2 316 339 1.47e-3 SMART
ZnF_C2H2 350 372 2.75e-3 SMART
ZnF_C2H2 383 408 3.34e-2 SMART
ZnF_C2H2 413 437 4.81e0 SMART
ZnF_C2H2 440 463 7.05e-1 SMART
ZnF_C2H2 469 492 2.17e-1 SMART
ZnF_C2H2 498 520 1.56e-2 SMART
ZnF_C2H2 526 548 8.94e-3 SMART
ZnF_C2H2 554 576 1.38e-3 SMART
ZnF_C2H2 582 604 9.44e-2 SMART
ZnF_C2H2 609 632 1.26e-2 SMART
ZnF_C2H2 641 664 1.31e0 SMART
ZnF_C2H2 670 693 2.63e0 SMART
low complexity region 800 816 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
ZnF_C2H2 936 956 2.01e1 SMART
ZnF_C2H2 966 986 1.91e1 SMART
low complexity region 1044 1057 N/A INTRINSIC
ZnF_C2H2 1084 1104 2.7e2 SMART
low complexity region 1106 1119 N/A INTRINSIC
ZnF_C2H2 1162 1182 3.56e1 SMART
ZnF_C2H2 1192 1215 4.98e-1 SMART
ZnF_C2H2 1228 1251 2.49e-1 SMART
ZnF_C2H2 1257 1279 1.03e-2 SMART
ZnF_C2H2 1285 1308 5.72e-1 SMART
ZnF_C2H2 1314 1337 6.75e0 SMART
ZnF_C2H2 1343 1366 9.58e-3 SMART
ZnF_C2H2 1385 1408 1.64e-1 SMART
ZnF_C2H2 1411 1433 1.1e-2 SMART
ZnF_C2H2 1437 1460 4.05e-1 SMART
ZnF_C2H2 1477 1499 4.45e0 SMART
ZnF_C2H2 1505 1527 8.81e-2 SMART
ZnF_C2H2 1533 1555 1.18e-2 SMART
ZnF_C2H2 1561 1583 1.2e-3 SMART
ZnF_C2H2 1589 1612 3.89e-3 SMART
ZnF_C2H2 1618 1640 4.54e-4 SMART
ZnF_C2H2 1646 1668 1.18e-2 SMART
ZnF_C2H2 1674 1696 3.52e-1 SMART
low complexity region 1726 1735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113749
SMART Domains Protein: ENSMUSP00000109378
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127921
Predicted Effect probably benign
Transcript: ENSMUST00000141412
SMART Domains Protein: ENSMUSP00000115322
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156613
Meta Mutation Damage Score 0.1909 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kruppel family of C2H2-type zinc finger proteins. It contains 31 C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C T 2: 32,379,413 probably null Het
1700074P13Rik A G 6: 40,921,021 W243R probably damaging Het
2510039O18Rik T A 4: 147,941,488 L155Q probably damaging Het
Aadac T C 3: 60,035,817 F48L probably benign Het
Aadat T A 8: 60,526,600 N165K probably benign Het
Acan C A 7: 79,092,718 D557E probably damaging Het
Adamts4 T A 1: 171,251,066 V85D probably benign Het
Agt A G 8: 124,556,937 V481A probably benign Het
Angpt1 T C 15: 42,676,401 N21D probably benign Het
Ankrd52 A C 10: 128,378,089 D38A probably damaging Het
Ap1g2 G T 14: 55,104,365 Q247K probably damaging Het
Apaf1 T C 10: 91,060,188 R341G probably damaging Het
Arf2 T C 11: 103,979,759 probably null Het
Arhgef1 A G 7: 24,918,576 probably benign Het
Bbox1 T A 2: 110,265,521 Y366F possibly damaging Het
Bmp3 A G 5: 98,872,558 E280G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 T A 15: 21,583,808 V578D possibly damaging Het
Cdk19 T C 10: 40,476,199 S282P probably damaging Het
Cfap46 A G 7: 139,679,323 probably null Het
Cfhr3 T A 1: 139,584,828 noncoding transcript Het
Ctrc T A 4: 141,841,523 Y123F probably benign Het
Enpp4 A G 17: 44,102,355 M96T probably damaging Het
Exosc10 T A 4: 148,562,394 S154T possibly damaging Het
Fbxo21 G A 5: 118,000,468 R486H probably benign Het
Foxj3 C A 4: 119,616,590 A204E probably damaging Het
Gas6 T G 8: 13,476,227 D237A probably benign Het
Gimap8 A G 6: 48,650,427 S112G probably benign Het
Gm4787 T C 12: 81,378,367 N339S possibly damaging Het
Gm6185 T C 1: 161,182,363 noncoding transcript Het
Gramd3 A G 18: 56,432,300 E9G probably benign Het
Hmgxb3 A T 18: 61,167,496 D169E probably benign Het
Isl2 T A 9: 55,544,312 V162D probably benign Het
Kcns3 T A 12: 11,091,654 D348V probably damaging Het
Kcp G A 6: 29,484,626 P1318S probably benign Het
Kif12 T A 4: 63,167,783 Q415L probably damaging Het
Lama3 T A 18: 12,504,359 H45Q probably benign Het
Lonp2 A T 8: 86,631,502 K117M probably benign Het
Loxl4 T A 19: 42,605,004 N243Y probably damaging Het
Lrif1 C A 3: 106,735,564 Q662K probably benign Het
Lrrc37a T A 11: 103,455,480 I3187L probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Mecom T G 3: 29,957,530 K865Q probably damaging Het
Myh10 T C 11: 68,785,314 I790T probably damaging Het
Nek7 C T 1: 138,498,673 S234N probably damaging Het
Nepro T C 16: 44,730,182 L179P probably damaging Het
Nexn A G 3: 152,237,722 C649R probably damaging Het
Nsmf T C 2: 25,055,026 S34P probably damaging Het
Olfr1140 C T 2: 87,746,508 T104I probably benign Het
Olfr1339 T A 4: 118,734,733 V68D possibly damaging Het
Olfr1350 A G 7: 6,570,851 I287V probably benign Het
Olfr1364 A G 13: 21,573,743 S238P possibly damaging Het
Olfr354 T A 2: 36,907,716 S257T probably benign Het
Olfr406 T A 11: 74,269,420 F10L probably benign Het
Olfr417 A G 1: 174,368,922 I2V probably benign Het
Olfr685 A T 7: 105,180,926 I144N probably damaging Het
Olfr702 A G 7: 106,824,307 F73S probably damaging Het
P2rx5 G T 11: 73,164,877 K53N probably damaging Het
Pcdhb20 C A 18: 37,506,131 A570E possibly damaging Het
Pip4k2c T C 10: 127,211,417 H32R unknown Het
Pkhd1 T A 1: 20,524,112 D1259V possibly damaging Het
Plekha7 A T 7: 116,137,311 V889E probably damaging Het
Polr2b A C 5: 77,332,039 E546D possibly damaging Het
Ppm1l A G 3: 69,549,328 T193A probably damaging Het
Ppp1r37 G T 7: 19,531,520 D710E probably benign Het
Prdm4 A G 10: 85,899,221 F679L probably damaging Het
Prkcd A G 14: 30,610,301 M1T probably null Het
Rcor3 A G 1: 192,130,449 Y77H unknown Het
Rdh5 T C 10: 128,918,366 E66G possibly damaging Het
Slc12a5 A G 2: 164,982,931 M396V probably benign Het
Slco5a1 T G 1: 12,879,280 T629P probably damaging Het
Smarca5 A C 8: 80,733,707 N133K probably benign Het
Spag5 T C 11: 78,320,052 M927T probably benign Het
Spint4 A T 2: 164,700,146 D39V probably damaging Het
Syt6 T A 3: 103,630,917 *512R probably null Het
Tmem247 T C 17: 86,922,342 C204R probably damaging Het
Tmem72 A G 6: 116,695,434 Y149H probably damaging Het
Trpm6 T C 19: 18,876,064 V1816A probably damaging Het
Usp35 A G 7: 97,310,339 V1008A possibly damaging Het
Washc4 T C 10: 83,591,052 S1075P probably damaging Het
Wdr34 T C 2: 30,033,920 T198A probably benign Het
Xylb G T 9: 119,359,313 G62* probably null Het
Zfp239 A G 6: 117,871,739 Y146C probably damaging Het
Other mutations in Zfp142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Zfp142 APN 1 74566972 missense probably damaging 1.00
IGL00711:Zfp142 APN 1 74572434 missense probably damaging 1.00
IGL01391:Zfp142 APN 1 74579540 missense probably damaging 1.00
IGL01808:Zfp142 APN 1 74576025 missense probably damaging 1.00
IGL02074:Zfp142 APN 1 74569863 missense probably damaging 0.97
IGL02134:Zfp142 APN 1 74569863 missense probably damaging 0.97
IGL02567:Zfp142 APN 1 74578147 missense possibly damaging 0.84
IGL02567:Zfp142 APN 1 74578149 missense possibly damaging 0.92
IGL02567:Zfp142 APN 1 74578150 missense possibly damaging 0.92
IGL02669:Zfp142 APN 1 74571273 missense probably benign 0.18
IGL02694:Zfp142 APN 1 74570148 missense probably damaging 0.98
IGL02884:Zfp142 APN 1 74571983 missense probably damaging 0.99
IGL03000:Zfp142 APN 1 74573618 missense probably benign 0.01
IGL03080:Zfp142 APN 1 74571209 missense probably benign 0.18
IGL03238:Zfp142 APN 1 74576278 missense probably benign 0.37
IGL03277:Zfp142 APN 1 74571034 missense probably damaging 1.00
PIT4402001:Zfp142 UTSW 1 74579528 missense probably damaging 1.00
R0124:Zfp142 UTSW 1 74568623 missense probably damaging 1.00
R0256:Zfp142 UTSW 1 74578158 missense probably benign
R0267:Zfp142 UTSW 1 74576064 missense probably benign 0.05
R0306:Zfp142 UTSW 1 74570182 missense probably damaging 1.00
R0321:Zfp142 UTSW 1 74569714 missense probably damaging 1.00
R0466:Zfp142 UTSW 1 74585411 missense possibly damaging 0.95
R0513:Zfp142 UTSW 1 74571555 missense probably damaging 1.00
R1084:Zfp142 UTSW 1 74571826 missense probably benign
R1534:Zfp142 UTSW 1 74572088 missense probably benign 0.00
R1548:Zfp142 UTSW 1 74570104 missense probably damaging 1.00
R1623:Zfp142 UTSW 1 74571775 missense possibly damaging 0.56
R1628:Zfp142 UTSW 1 74571888 missense possibly damaging 0.94
R1710:Zfp142 UTSW 1 74572230 missense probably damaging 1.00
R1722:Zfp142 UTSW 1 74569776 missense probably damaging 1.00
R1770:Zfp142 UTSW 1 74579631 missense probably damaging 0.99
R2042:Zfp142 UTSW 1 74570619 missense probably benign 0.10
R2112:Zfp142 UTSW 1 74573636 missense probably damaging 1.00
R2249:Zfp142 UTSW 1 74567032 missense probably damaging 1.00
R4393:Zfp142 UTSW 1 74572060 missense probably benign 0.00
R4700:Zfp142 UTSW 1 74570272 missense probably damaging 1.00
R4763:Zfp142 UTSW 1 74576512 missense probably damaging 1.00
R5208:Zfp142 UTSW 1 74570868 missense probably benign 0.18
R5233:Zfp142 UTSW 1 74585449 missense probably damaging 1.00
R5585:Zfp142 UTSW 1 74578245 nonsense probably null
R6192:Zfp142 UTSW 1 74570508 missense probably damaging 1.00
R6461:Zfp142 UTSW 1 74567185 missense probably damaging 1.00
R6482:Zfp142 UTSW 1 74570217 splice site probably null
R7320:Zfp142 UTSW 1 74570008 nonsense probably null
R7438:Zfp142 UTSW 1 74585520 missense probably benign
R7528:Zfp142 UTSW 1 74570902 missense probably benign 0.00
R7600:Zfp142 UTSW 1 74573668 missense probably damaging 1.00
R8007:Zfp142 UTSW 1 74571496 missense probably benign 0.01
R8681:Zfp142 UTSW 1 74571588 missense probably damaging 1.00
R8772:Zfp142 UTSW 1 74571666 missense possibly damaging 0.87
Z1177:Zfp142 UTSW 1 74570166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTTACGCTTGTGGAAG -3'
(R):5'- GCCTTGCTCTACTCAAGATTACG -3'

Sequencing Primer
(F):5'- GGTATTGCTAAAGGTACGGTAGTCAC -3'
(R):5'- GTGAAATCAGCTGGTTCACC -3'
Posted On2015-11-11