Incidental Mutation 'R4750:Wdr34'
List |< first << previous [record 81 of 84] next >> last >|
ID357464
Institutional Source Beutler Lab
Gene Symbol Wdr34
Ensembl Gene ENSMUSG00000039715
Gene NameWD repeat domain 34
Synonyms
MMRRC Submission 042031-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4750 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30031546-30048881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30033920 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 198 (T198A)
Ref Sequence ENSEMBL: ENSMUSP00000109340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113711] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
Predicted Effect probably benign
Transcript: ENSMUST00000046257
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095083
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113711
AA Change: T198A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109340
Gene: ENSMUSG00000039715
AA Change: T198A

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
low complexity region 90 100 N/A INTRINSIC
Blast:WD40 146 200 3e-28 BLAST
WD40 207 247 2e-1 SMART
WD40 256 300 3.42e1 SMART
Blast:WD40 323 364 8e-10 BLAST
WD40 382 422 1.66e-5 SMART
WD40 425 465 3.09e-1 SMART
WD40 470 512 4.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113719
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124494
Predicted Effect probably benign
Transcript: ENSMUST00000129241
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201758
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Defects in this gene are a cause of short-rib thoracic dysplasia 11 with or without polydactyly. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C T 2: 32,379,413 probably null Het
1700074P13Rik A G 6: 40,921,021 W243R probably damaging Het
2510039O18Rik T A 4: 147,941,488 L155Q probably damaging Het
Aadac T C 3: 60,035,817 F48L probably benign Het
Aadat T A 8: 60,526,600 N165K probably benign Het
Acan C A 7: 79,092,718 D557E probably damaging Het
Adamts4 T A 1: 171,251,066 V85D probably benign Het
Agt A G 8: 124,556,937 V481A probably benign Het
Angpt1 T C 15: 42,676,401 N21D probably benign Het
Ankrd52 A C 10: 128,378,089 D38A probably damaging Het
Ap1g2 G T 14: 55,104,365 Q247K probably damaging Het
Apaf1 T C 10: 91,060,188 R341G probably damaging Het
Arf2 T C 11: 103,979,759 probably null Het
Arhgef1 A G 7: 24,918,576 probably benign Het
Bbox1 T A 2: 110,265,521 Y366F possibly damaging Het
Bmp3 A G 5: 98,872,558 E280G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 T A 15: 21,583,808 V578D possibly damaging Het
Cdk19 T C 10: 40,476,199 S282P probably damaging Het
Cfap46 A G 7: 139,679,323 probably null Het
Cfhr3 T A 1: 139,584,828 noncoding transcript Het
Ctrc T A 4: 141,841,523 Y123F probably benign Het
Enpp4 A G 17: 44,102,355 M96T probably damaging Het
Exosc10 T A 4: 148,562,394 S154T possibly damaging Het
Fbxo21 G A 5: 118,000,468 R486H probably benign Het
Foxj3 C A 4: 119,616,590 A204E probably damaging Het
Gas6 T G 8: 13,476,227 D237A probably benign Het
Gimap8 A G 6: 48,650,427 S112G probably benign Het
Gm4787 T C 12: 81,378,367 N339S possibly damaging Het
Gm6185 T C 1: 161,182,363 noncoding transcript Het
Gramd3 A G 18: 56,432,300 E9G probably benign Het
Hmgxb3 A T 18: 61,167,496 D169E probably benign Het
Isl2 T A 9: 55,544,312 V162D probably benign Het
Kcns3 T A 12: 11,091,654 D348V probably damaging Het
Kcp G A 6: 29,484,626 P1318S probably benign Het
Kif12 T A 4: 63,167,783 Q415L probably damaging Het
Lama3 T A 18: 12,504,359 H45Q probably benign Het
Lonp2 A T 8: 86,631,502 K117M probably benign Het
Loxl4 T A 19: 42,605,004 N243Y probably damaging Het
Lrif1 C A 3: 106,735,564 Q662K probably benign Het
Lrrc37a T A 11: 103,455,480 I3187L probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Mecom T G 3: 29,957,530 K865Q probably damaging Het
Myh10 T C 11: 68,785,314 I790T probably damaging Het
Nek7 C T 1: 138,498,673 S234N probably damaging Het
Nepro T C 16: 44,730,182 L179P probably damaging Het
Nexn A G 3: 152,237,722 C649R probably damaging Het
Nsmf T C 2: 25,055,026 S34P probably damaging Het
Olfr1140 C T 2: 87,746,508 T104I probably benign Het
Olfr1339 T A 4: 118,734,733 V68D possibly damaging Het
Olfr1350 A G 7: 6,570,851 I287V probably benign Het
Olfr1364 A G 13: 21,573,743 S238P possibly damaging Het
Olfr354 T A 2: 36,907,716 S257T probably benign Het
Olfr406 T A 11: 74,269,420 F10L probably benign Het
Olfr417 A G 1: 174,368,922 I2V probably benign Het
Olfr685 A T 7: 105,180,926 I144N probably damaging Het
Olfr702 A G 7: 106,824,307 F73S probably damaging Het
P2rx5 G T 11: 73,164,877 K53N probably damaging Het
Pcdhb20 C A 18: 37,506,131 A570E possibly damaging Het
Pip4k2c T C 10: 127,211,417 H32R unknown Het
Pkhd1 T A 1: 20,524,112 D1259V possibly damaging Het
Plekha7 A T 7: 116,137,311 V889E probably damaging Het
Polr2b A C 5: 77,332,039 E546D possibly damaging Het
Ppm1l A G 3: 69,549,328 T193A probably damaging Het
Ppp1r37 G T 7: 19,531,520 D710E probably benign Het
Prdm4 A G 10: 85,899,221 F679L probably damaging Het
Prkcd A G 14: 30,610,301 M1T probably null Het
Rcor3 A G 1: 192,130,449 Y77H probably damaging Het
Rdh5 T C 10: 128,918,366 E66G possibly damaging Het
Slc12a5 A G 2: 164,982,931 M396V probably benign Het
Slco5a1 T G 1: 12,879,280 T629P probably damaging Het
Smarca5 A C 8: 80,733,707 N133K probably benign Het
Spag5 T C 11: 78,320,052 M927T probably benign Het
Spint4 A T 2: 164,700,146 D39V probably damaging Het
Syt6 T A 3: 103,630,917 *512R probably null Het
Tmem247 T C 17: 86,922,342 C204R probably damaging Het
Tmem72 A G 6: 116,695,434 Y149H probably damaging Het
Trpm6 T C 19: 18,876,064 V1816A probably damaging Het
Usp35 A G 7: 97,310,339 V1008A possibly damaging Het
Washc4 T C 10: 83,591,052 S1075P probably damaging Het
Xylb G T 9: 119,359,313 G62* probably null Het
Zfp142 T C 1: 74,572,458 E623G probably damaging Het
Zfp239 A G 6: 117,871,739 Y146C probably damaging Het
Other mutations in Wdr34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Wdr34 APN 2 30038390 missense probably benign 0.11
IGL02165:Wdr34 APN 2 30032160 missense probably benign
IGL02600:Wdr34 APN 2 30033302 missense possibly damaging 0.65
PIT1430001:Wdr34 UTSW 2 30032135 missense probably damaging 1.00
R0542:Wdr34 UTSW 2 30031825 missense probably damaging 0.98
R4065:Wdr34 UTSW 2 30032808 missense probably benign 0.03
R4067:Wdr34 UTSW 2 30032808 missense probably benign 0.03
R4907:Wdr34 UTSW 2 30032460 unclassified probably null
R5008:Wdr34 UTSW 2 30032769 missense probably benign 0.14
R5253:Wdr34 UTSW 2 30032363 unclassified probably benign
R6014:Wdr34 UTSW 2 30031751 missense probably benign 0.01
R6456:Wdr34 UTSW 2 30032767 missense probably benign 0.01
R6789:Wdr34 UTSW 2 30033272 critical splice donor site probably null
R7024:Wdr34 UTSW 2 30038266 missense possibly damaging 0.61
R7319:Wdr34 UTSW 2 30038329 missense probably benign 0.00
R7576:Wdr34 UTSW 2 30048778 missense probably benign 0.00
R7640:Wdr34 UTSW 2 30031768 missense probably benign 0.00
R8025:Wdr34 UTSW 2 30048718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGATTCCTCCCTCCAAGC -3'
(R):5'- GAGAACATCGTGCCCATAGG -3'

Sequencing Primer
(F):5'- AGGTCCACACTGGCAGGTTAG -3'
(R):5'- CATAGTACAGTCTGGGTGTG -3'
Posted On2015-11-11