Incidental Mutation 'R0403:Flrt1'
ID35748
Institutional Source Beutler Lab
Gene Symbol Flrt1
Ensembl Gene ENSMUSG00000047787
Gene Namefibronectin leucine rich transmembrane protein 1
SynonymsD630040I23Rik
MMRRC Submission 038608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R0403 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7092014-7105729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7095919 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 421 (L421P)
Ref Sequence ENSEMBL: ENSMUSP00000109010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040261] [ENSMUST00000113383]
Predicted Effect probably benign
Transcript: ENSMUST00000040261
SMART Domains Protein: ENSMUSP00000039507
Gene: ENSMUSG00000036278

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 25 41 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
A1pp 151 281 7.67e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113383
AA Change: L421P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109010
Gene: ENSMUSG00000047787
AA Change: L421P

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRRNT 53 85 4.11e-6 SMART
LRR 127 149 2.61e1 SMART
LRR 150 175 4.71e1 SMART
LRR 177 199 1.76e1 SMART
LRR 200 220 7.36e0 SMART
LRR 221 246 1.49e1 SMART
LRR 247 270 9.77e1 SMART
LRR 271 292 1.53e1 SMART
LRR_TYP 293 316 3.55e-6 SMART
LRRCT 328 379 5.19e-9 SMART
low complexity region 381 392 N/A INTRINSIC
FN3 434 515 1.49e0 SMART
transmembrane domain 556 578 N/A INTRINSIC
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. The family members may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. The encoded protein shares sequence similarity with two other family members, FLRT2 and FLRT3. This gene is expressed in kidney and brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 probably null Het
Adgrg3 C T 8: 95,036,922 L284F probably benign Het
Alkbh8 T A 9: 3,385,469 V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 M590K probably benign Het
Arhgap15 C T 2: 44,063,766 T168I probably damaging Het
Arntl2 T A 6: 146,822,655 H348Q probably damaging Het
Atp8b1 A G 18: 64,540,310 V997A probably damaging Het
Atrn G A 2: 130,906,859 C100Y probably damaging Het
Baiap2l2 C A 15: 79,271,216 A151S probably benign Het
Baz2b A T 2: 59,969,377 D199E possibly damaging Het
Cblb A G 16: 52,152,626 D440G probably benign Het
Cdon T C 9: 35,473,500 V694A probably benign Het
Cep250 A T 2: 155,992,349 R2065W probably damaging Het
Ces2b G T 8: 104,833,945 A131S probably damaging Het
Chrna9 A T 5: 65,967,892 T59S possibly damaging Het
Cog3 T A 14: 75,742,327 probably benign Het
Cpa1 G A 6: 30,641,857 V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 probably null Het
Ddx60 A G 8: 61,994,541 probably benign Het
Dhx16 T C 17: 35,883,050 probably null Het
Dnah9 T A 11: 66,084,789 Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 D325V probably damaging Het
Entpd6 C A 2: 150,760,170 T194K possibly damaging Het
Fam208b A T 13: 3,582,052 Y816* probably null Het
Fat2 A T 11: 55,270,349 V3185E probably benign Het
Fmn2 A T 1: 174,694,278 Q1292L probably damaging Het
Fndc1 T C 17: 7,753,723 D1459G probably damaging Het
Fndc1 T C 17: 7,775,588 probably null Het
Fzr1 A G 10: 81,369,368 S265P possibly damaging Het
Gm13119 A G 4: 144,362,646 N178S probably benign Het
Gm14085 T C 2: 122,521,854 L364S probably damaging Het
Gpr142 G A 11: 114,806,029 V134M probably damaging Het
Grid2ip G T 5: 143,357,620 V24L possibly damaging Het
Herc2 G A 7: 56,159,417 R2555H probably damaging Het
Hpdl A T 4: 116,820,479 Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 I186V probably benign Het
Itga2b C T 11: 102,467,326 probably null Het
Itgae A C 11: 73,123,183 D736A possibly damaging Het
Itpkc T A 7: 27,208,345 M645L probably benign Het
Jchain T C 5: 88,521,378 R139G probably benign Het
Kif13a A G 13: 46,791,401 V908A probably damaging Het
Kif1b T A 4: 149,181,967 K389* probably null Het
Klhl12 T C 1: 134,485,856 Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 R148W probably damaging Het
Lpar1 T A 4: 58,487,191 N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Lum G T 10: 97,572,043 V337F probably benign Het
Mag T C 7: 30,906,980 D344G probably damaging Het
Maip1 G A 1: 57,407,196 A142T probably benign Het
Mlh3 A G 12: 85,268,968 V148A possibly damaging Het
Nav3 A G 10: 109,767,103 V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 S868P possibly damaging Het
Nek1 A G 8: 61,106,855 E907G probably damaging Het
Nfam1 G A 15: 83,016,379 T134I probably benign Het
Nr0b2 T C 4: 133,553,759 V112A probably damaging Het
Nrp1 A G 8: 128,457,969 N365S probably damaging Het
Nrsn2 T C 2: 152,369,790 Y107C probably damaging Het
Ntng1 G A 3: 109,934,611 A282V probably damaging Het
Nxf1 T C 19: 8,765,028 I337T probably damaging Het
Obscn C T 11: 59,076,540 G479D probably damaging Het
Olfr45 T C 7: 140,691,309 S135P possibly damaging Het
Oprd1 T A 4: 132,113,768 D293V probably benign Het
P3h2 T G 16: 25,969,950 N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Ppic C A 18: 53,411,071 G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 S46A probably benign Het
Prkce A G 17: 86,168,653 T21A probably damaging Het
Prkg2 T C 5: 98,994,645 E210G possibly damaging Het
Prss35 A G 9: 86,756,037 M287V probably damaging Het
Psd G A 19: 46,320,972 probably benign Het
Ptch2 A T 4: 117,110,839 K843* probably null Het
Rab44 C A 17: 29,145,261 T603K probably damaging Het
Rasal3 T A 17: 32,392,790 probably null Het
Rbbp6 A G 7: 122,992,296 T526A probably damaging Het
Ros1 A T 10: 52,143,438 probably benign Het
Sec24b T A 3: 129,989,676 L1104F possibly damaging Het
Sec24b A G 3: 129,999,534 S685P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setmar A T 6: 108,075,962 H139L probably benign Het
Slc4a7 T C 14: 14,766,808 V710A probably benign Het
Smarcc1 T A 9: 110,237,808 probably null Het
Smchd1 G A 17: 71,394,902 L1032F probably damaging Het
Speg T C 1: 75,430,784 probably benign Het
Tcea1 C G 1: 4,889,503 R134G probably benign Het
Tchhl1 C T 3: 93,471,029 Q347* probably null Het
Tecrl A T 5: 83,354,758 probably benign Het
Tepsin T C 11: 120,093,682 probably benign Het
Tmem40 G A 6: 115,733,985 probably benign Het
Tpr G A 1: 150,407,414 probably benign Het
Ttll12 A T 15: 83,580,658 probably benign Het
Ttn T A 2: 76,909,608 D3529V probably benign Het
Usp34 T A 11: 23,333,838 H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 S327T probably benign Het
Zbtb4 T A 11: 69,777,639 M396K probably damaging Het
Zfp352 C T 4: 90,225,009 T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 M145V probably damaging Het
Zfp780b C A 7: 27,971,689 V65F possibly damaging Het
Other mutations in Flrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Flrt1 APN 19 7096912 missense probably damaging 1.00
IGL01082:Flrt1 APN 19 7095974 missense probably benign
IGL02535:Flrt1 APN 19 7096733 missense probably benign 0.00
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0645:Flrt1 UTSW 19 7097143 intron probably benign
R0677:Flrt1 UTSW 19 7096179 nonsense probably null
R1818:Flrt1 UTSW 19 7095346 missense probably damaging 1.00
R2191:Flrt1 UTSW 19 7095829 missense probably damaging 0.99
R2228:Flrt1 UTSW 19 7095358 missense probably damaging 1.00
R2471:Flrt1 UTSW 19 7096491 missense probably damaging 1.00
R4978:Flrt1 UTSW 19 7096876 missense probably damaging 1.00
R5460:Flrt1 UTSW 19 7095740 missense probably damaging 0.99
R5630:Flrt1 UTSW 19 7096465 missense probably damaging 1.00
R6326:Flrt1 UTSW 19 7096609 missense probably damaging 1.00
R6734:Flrt1 UTSW 19 7096159 missense possibly damaging 0.91
R6905:Flrt1 UTSW 19 7095392 nonsense probably null
R7239:Flrt1 UTSW 19 7095964 missense probably benign 0.12
R7799:Flrt1 UTSW 19 7095864 missense possibly damaging 0.78
X0024:Flrt1 UTSW 19 7095749 missense probably damaging 1.00
X0062:Flrt1 UTSW 19 7096879 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAGCAAGTACTCTGTCTTGTCCC -3'
(R):5'- TCAGGAACAACCCCTGGTTCTGTG -3'

Sequencing Primer
(F):5'- AGGGTCTCTGTTATAGAGCCCAC -3'
(R):5'- AACCTCATGTGGCTGAGGG -3'
Posted On2013-05-09