Incidental Mutation 'R4750:Exosc10'
List |< first << previous [record 24 of 84] next >> last >|
ID357482
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission 042031-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4750 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148562394 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 154 (S154T)
Ref Sequence ENSEMBL: ENSMUSP00000017408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781] [ENSMUST00000103221]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017408
AA Change: S154T

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: S154T

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076022
AA Change: S154T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: S154T

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097781
AA Change: S154T

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264
AA Change: S154T

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103221
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173767
Meta Mutation Damage Score 0.1891 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (89/92)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C T 2: 32,379,413 probably null Het
1700074P13Rik A G 6: 40,921,021 W243R probably damaging Het
2510039O18Rik T A 4: 147,941,488 L155Q probably damaging Het
Aadac T C 3: 60,035,817 F48L probably benign Het
Aadat T A 8: 60,526,600 N165K probably benign Het
Acan C A 7: 79,092,718 D557E probably damaging Het
Adamts4 T A 1: 171,251,066 V85D probably benign Het
Agt A G 8: 124,556,937 V481A probably benign Het
Angpt1 T C 15: 42,676,401 N21D probably benign Het
Ankrd52 A C 10: 128,378,089 D38A probably damaging Het
Ap1g2 G T 14: 55,104,365 Q247K probably damaging Het
Apaf1 T C 10: 91,060,188 R341G probably damaging Het
Arf2 T C 11: 103,979,759 probably null Het
Arhgef1 A G 7: 24,918,576 probably benign Het
Bbox1 T A 2: 110,265,521 Y366F possibly damaging Het
Bmp3 A G 5: 98,872,558 E280G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 T A 15: 21,583,808 V578D possibly damaging Het
Cdk19 T C 10: 40,476,199 S282P probably damaging Het
Cfap46 A G 7: 139,679,323 probably null Het
Cfhr3 T A 1: 139,584,828 noncoding transcript Het
Ctrc T A 4: 141,841,523 Y123F probably benign Het
Enpp4 A G 17: 44,102,355 M96T probably damaging Het
Fbxo21 G A 5: 118,000,468 R486H probably benign Het
Foxj3 C A 4: 119,616,590 A204E probably damaging Het
Gas6 T G 8: 13,476,227 D237A probably benign Het
Gimap8 A G 6: 48,650,427 S112G probably benign Het
Gm4787 T C 12: 81,378,367 N339S possibly damaging Het
Gm6185 T C 1: 161,182,363 noncoding transcript Het
Gramd3 A G 18: 56,432,300 E9G probably benign Het
Hmgxb3 A T 18: 61,167,496 D169E probably benign Het
Isl2 T A 9: 55,544,312 V162D probably benign Het
Kcns3 T A 12: 11,091,654 D348V probably damaging Het
Kcp G A 6: 29,484,626 P1318S probably benign Het
Kif12 T A 4: 63,167,783 Q415L probably damaging Het
Lama3 T A 18: 12,504,359 H45Q probably benign Het
Lonp2 A T 8: 86,631,502 K117M probably benign Het
Loxl4 T A 19: 42,605,004 N243Y probably damaging Het
Lrif1 C A 3: 106,735,564 Q662K probably benign Het
Lrrc37a T A 11: 103,455,480 I3187L probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Mecom T G 3: 29,957,530 K865Q probably damaging Het
Myh10 T C 11: 68,785,314 I790T probably damaging Het
Nek7 C T 1: 138,498,673 S234N probably damaging Het
Nepro T C 16: 44,730,182 L179P probably damaging Het
Nexn A G 3: 152,237,722 C649R probably damaging Het
Nsmf T C 2: 25,055,026 S34P probably damaging Het
Olfr1140 C T 2: 87,746,508 T104I probably benign Het
Olfr1339 T A 4: 118,734,733 V68D possibly damaging Het
Olfr1350 A G 7: 6,570,851 I287V probably benign Het
Olfr1364 A G 13: 21,573,743 S238P possibly damaging Het
Olfr354 T A 2: 36,907,716 S257T probably benign Het
Olfr406 T A 11: 74,269,420 F10L probably benign Het
Olfr417 A G 1: 174,368,922 I2V probably benign Het
Olfr685 A T 7: 105,180,926 I144N probably damaging Het
Olfr702 A G 7: 106,824,307 F73S probably damaging Het
P2rx5 G T 11: 73,164,877 K53N probably damaging Het
Pcdhb20 C A 18: 37,506,131 A570E possibly damaging Het
Pip4k2c T C 10: 127,211,417 H32R unknown Het
Pkhd1 T A 1: 20,524,112 D1259V possibly damaging Het
Plekha7 A T 7: 116,137,311 V889E probably damaging Het
Polr2b A C 5: 77,332,039 E546D possibly damaging Het
Ppm1l A G 3: 69,549,328 T193A probably damaging Het
Ppp1r37 G T 7: 19,531,520 D710E probably benign Het
Prdm4 A G 10: 85,899,221 F679L probably damaging Het
Prkcd A G 14: 30,610,301 M1T probably null Het
Rcor3 A G 1: 192,130,449 Y77H probably damaging Het
Rdh5 T C 10: 128,918,366 E66G possibly damaging Het
Slc12a5 A G 2: 164,982,931 M396V probably benign Het
Slco5a1 T G 1: 12,879,280 T629P probably damaging Het
Smarca5 A C 8: 80,733,707 N133K probably benign Het
Spag5 T C 11: 78,320,052 M927T probably benign Het
Spint4 A T 2: 164,700,146 D39V probably damaging Het
Syt6 T A 3: 103,630,917 *512R probably null Het
Tmem247 T C 17: 86,922,342 C204R probably damaging Het
Tmem72 A G 6: 116,695,434 Y149H probably damaging Het
Trpm6 T C 19: 18,876,064 V1816A probably damaging Het
Usp35 A G 7: 97,310,339 V1008A possibly damaging Het
Washc4 T C 10: 83,591,052 S1075P probably damaging Het
Wdr34 T C 2: 30,033,920 T198A probably benign Het
Xylb G T 9: 119,359,313 G62* probably null Het
Zfp142 T C 1: 74,572,458 E623G probably damaging Het
Zfp239 A G 6: 117,871,739 Y146C probably damaging Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 synonymous probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACGTATTTCTGTGACTACG -3'
(R):5'- TCTCAGGACCACACATTTGGAATG -3'

Sequencing Primer
(F):5'- ACTACGTTTCTTGAGGATGTCAG -3'
(R):5'- GGGTTCAAGTGCCACATGG -3'
Posted On2015-11-11