Incidental Mutation 'R4750:Gas6'
ID357502
Institutional Source Beutler Lab
Gene Symbol Gas6
Ensembl Gene ENSMUSG00000031451
Gene Namegrowth arrest specific 6
Synonymsgrowth arrest-specific, Gas-6, GAS 6
MMRRC Submission 042031-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4750 (G1)
Quality Score178
Status Validated
Chromosome8
Chromosomal Location13465374-13494490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13476227 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 237 (D237A)
Ref Sequence ENSEMBL: ENSMUSP00000033828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033828]
Predicted Effect probably benign
Transcript: ENSMUST00000033828
AA Change: D237A

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033828
Gene: ENSMUSG00000031451
AA Change: D237A

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
GLA 26 90 6.66e-30 SMART
EGF 116 151 3.97e0 SMART
EGF_CA 153 193 3.1e-11 SMART
EGF_CA 194 234 1.91e-11 SMART
EGF_CA 235 275 1.25e-6 SMART
LamG 314 450 2.71e-24 SMART
LamG 502 647 1.27e-15 SMART
Meta Mutation Damage Score 0.3837 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation. This gene is frequently overexpressed in many cancers and has been implicated as an adverse prognostic marker. Elevated protein levels are additionally associated with a variety of disease states, including venous thromboembolic disease, systemic lupus erythematosus, chronic renal failure, and preeclampsia. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice are protected against arterial and venous thrombosis, and though platelet aggregation is impaired, spontaneous or excess trauma-induced bleeding is not observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008P14Rik C T 2: 32,379,413 probably null Het
1700074P13Rik A G 6: 40,921,021 W243R probably damaging Het
2510039O18Rik T A 4: 147,941,488 L155Q probably damaging Het
Aadac T C 3: 60,035,817 F48L probably benign Het
Aadat T A 8: 60,526,600 N165K probably benign Het
Acan C A 7: 79,092,718 D557E probably damaging Het
Adamts4 T A 1: 171,251,066 V85D probably benign Het
Agt A G 8: 124,556,937 V481A probably benign Het
Angpt1 T C 15: 42,676,401 N21D probably benign Het
Ankrd52 A C 10: 128,378,089 D38A probably damaging Het
Ap1g2 G T 14: 55,104,365 Q247K probably damaging Het
Apaf1 T C 10: 91,060,188 R341G probably damaging Het
Arf2 T C 11: 103,979,759 probably null Het
Arhgef1 A G 7: 24,918,576 probably benign Het
Bbox1 T A 2: 110,265,521 Y366F possibly damaging Het
Bmp3 A G 5: 98,872,558 E280G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 T A 15: 21,583,808 V578D possibly damaging Het
Cdk19 T C 10: 40,476,199 S282P probably damaging Het
Cfap46 A G 7: 139,679,323 probably null Het
Cfhr3 T A 1: 139,584,828 noncoding transcript Het
Ctrc T A 4: 141,841,523 Y123F probably benign Het
Enpp4 A G 17: 44,102,355 M96T probably damaging Het
Exosc10 T A 4: 148,562,394 S154T possibly damaging Het
Fbxo21 G A 5: 118,000,468 R486H probably benign Het
Foxj3 C A 4: 119,616,590 A204E probably damaging Het
Gimap8 A G 6: 48,650,427 S112G probably benign Het
Gm4787 T C 12: 81,378,367 N339S possibly damaging Het
Gm6185 T C 1: 161,182,363 noncoding transcript Het
Gramd3 A G 18: 56,432,300 E9G probably benign Het
Hmgxb3 A T 18: 61,167,496 D169E probably benign Het
Isl2 T A 9: 55,544,312 V162D probably benign Het
Kcns3 T A 12: 11,091,654 D348V probably damaging Het
Kcp G A 6: 29,484,626 P1318S probably benign Het
Kif12 T A 4: 63,167,783 Q415L probably damaging Het
Lama3 T A 18: 12,504,359 H45Q probably benign Het
Lonp2 A T 8: 86,631,502 K117M probably benign Het
Loxl4 T A 19: 42,605,004 N243Y probably damaging Het
Lrif1 C A 3: 106,735,564 Q662K probably benign Het
Lrrc37a T A 11: 103,455,480 I3187L probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Mecom T G 3: 29,957,530 K865Q probably damaging Het
Myh10 T C 11: 68,785,314 I790T probably damaging Het
Nek7 C T 1: 138,498,673 S234N probably damaging Het
Nepro T C 16: 44,730,182 L179P probably damaging Het
Nexn A G 3: 152,237,722 C649R probably damaging Het
Nsmf T C 2: 25,055,026 S34P probably damaging Het
Olfr1140 C T 2: 87,746,508 T104I probably benign Het
Olfr1339 T A 4: 118,734,733 V68D possibly damaging Het
Olfr1350 A G 7: 6,570,851 I287V probably benign Het
Olfr1364 A G 13: 21,573,743 S238P possibly damaging Het
Olfr354 T A 2: 36,907,716 S257T probably benign Het
Olfr406 T A 11: 74,269,420 F10L probably benign Het
Olfr417 A G 1: 174,368,922 I2V probably benign Het
Olfr685 A T 7: 105,180,926 I144N probably damaging Het
Olfr702 A G 7: 106,824,307 F73S probably damaging Het
P2rx5 G T 11: 73,164,877 K53N probably damaging Het
Pcdhb20 C A 18: 37,506,131 A570E possibly damaging Het
Pip4k2c T C 10: 127,211,417 H32R unknown Het
Pkhd1 T A 1: 20,524,112 D1259V possibly damaging Het
Plekha7 A T 7: 116,137,311 V889E probably damaging Het
Polr2b A C 5: 77,332,039 E546D possibly damaging Het
Ppm1l A G 3: 69,549,328 T193A probably damaging Het
Ppp1r37 G T 7: 19,531,520 D710E probably benign Het
Prdm4 A G 10: 85,899,221 F679L probably damaging Het
Prkcd A G 14: 30,610,301 M1T probably null Het
Rcor3 A G 1: 192,130,449 Y77H probably damaging Het
Rdh5 T C 10: 128,918,366 E66G possibly damaging Het
Slc12a5 A G 2: 164,982,931 M396V probably benign Het
Slco5a1 T G 1: 12,879,280 T629P probably damaging Het
Smarca5 A C 8: 80,733,707 N133K probably benign Het
Spag5 T C 11: 78,320,052 M927T probably benign Het
Spint4 A T 2: 164,700,146 D39V probably damaging Het
Syt6 T A 3: 103,630,917 *512R probably null Het
Tmem247 T C 17: 86,922,342 C204R probably damaging Het
Tmem72 A G 6: 116,695,434 Y149H probably damaging Het
Trpm6 T C 19: 18,876,064 V1816A probably damaging Het
Usp35 A G 7: 97,310,339 V1008A possibly damaging Het
Washc4 T C 10: 83,591,052 S1075P probably damaging Het
Wdr34 T C 2: 30,033,920 T198A probably benign Het
Xylb G T 9: 119,359,313 G62* probably null Het
Zfp142 T C 1: 74,572,458 E623G probably damaging Het
Zfp239 A G 6: 117,871,739 Y146C probably damaging Het
Other mutations in Gas6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Gas6 APN 8 13476171 missense probably damaging 0.99
IGL01100:Gas6 APN 8 13475118 missense probably benign 0.27
IGL02014:Gas6 APN 8 13468359 missense possibly damaging 0.59
IGL02931:Gas6 APN 8 13477136 missense probably damaging 0.98
R0023:Gas6 UTSW 8 13470344 missense probably damaging 1.00
R0497:Gas6 UTSW 8 13470387 missense possibly damaging 0.86
R1126:Gas6 UTSW 8 13483700 missense probably benign 0.02
R1597:Gas6 UTSW 8 13493901 missense probably damaging 1.00
R1601:Gas6 UTSW 8 13465786 missense probably damaging 1.00
R1643:Gas6 UTSW 8 13465902 critical splice acceptor site probably null
R1914:Gas6 UTSW 8 13477152 missense probably benign
R1967:Gas6 UTSW 8 13470317 missense probably damaging 0.98
R2012:Gas6 UTSW 8 13468266 missense probably damaging 1.00
R4663:Gas6 UTSW 8 13470254 missense probably damaging 1.00
R4723:Gas6 UTSW 8 13466848 missense probably damaging 0.99
R4869:Gas6 UTSW 8 13475086 missense possibly damaging 0.55
R5558:Gas6 UTSW 8 13466764 missense probably null 0.03
R5706:Gas6 UTSW 8 13477098 missense probably damaging 0.98
R5791:Gas6 UTSW 8 13470217 critical splice donor site probably null
R6767:Gas6 UTSW 8 13465784 missense probably damaging 0.98
R6825:Gas6 UTSW 8 13483674 missense probably benign 0.00
R7374:Gas6 UTSW 8 13474802 missense probably damaging 0.99
R7419:Gas6 UTSW 8 13471456 missense probably benign 0.19
R7588:Gas6 UTSW 8 13466711 missense probably benign 0.03
R7810:Gas6 UTSW 8 13466809 missense probably damaging 1.00
X0063:Gas6 UTSW 8 13471538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTATTCAAAGCCAGGCAC -3'
(R):5'- ACAACCTTGGTCCCTCCATG -3'

Sequencing Primer
(F):5'- ACTGGGGGCTTCACGAG -3'
(R):5'- GTCAGTCTGAGCACAGTCCTC -3'
Posted On2015-11-11