Incidental Mutation 'R4751:Vgf'
ID357579
Institutional Source Beutler Lab
Gene Symbol Vgf
Ensembl Gene ENSMUSG00000037428
Gene NameVGF nerve growth factor inducible
SynonymsLOC381677
MMRRC Submission 041970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4751 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137026392-137033351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137032401 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 472 (D472E)
Ref Sequence ENSEMBL: ENSMUSP00000140815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041543] [ENSMUST00000111080] [ENSMUST00000144303] [ENSMUST00000150603] [ENSMUST00000186451] [ENSMUST00000187382] [ENSMUST00000190827]
Predicted Effect probably damaging
Transcript: ENSMUST00000041543
AA Change: D472E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048273
Gene: ENSMUSG00000037428
AA Change: D472E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111080
SMART Domains Protein: ENSMUSP00000106709
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144303
SMART Domains Protein: ENSMUSP00000120895
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150603
SMART Domains Protein: ENSMUSP00000115941
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 34 175 2.4e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154183
Predicted Effect probably damaging
Transcript: ENSMUST00000186451
AA Change: D472E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140735
Gene: ENSMUSG00000037428
AA Change: D472E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187382
SMART Domains Protein: ENSMUSP00000140093
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190827
AA Change: D472E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140815
Gene: ENSMUSG00000037428
AA Change: D472E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (124/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in a subpopulation of neuroendocrine cells, and is upregulated by nerve growth factor. The structural organization of this gene is similar to that of the rat gene, and both the translated and the untranslated regions show a high degree of sequence similarity to the rat gene. The encoded secretory protein also shares similarities with the secretogranin/chromogranin family, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are small, lean, hyperactive, hypermetabolic, and infertile. Mutants exhibit markedly reduced leptin levels and altered hypothalamic proopiomelanocortin, neuropeptide Y, and agouti-related peptide expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A T 7: 128,237,086 C112S probably benign Het
Abca13 G A 11: 9,277,973 probably null Het
Abca14 A G 7: 120,312,177 E1328G probably benign Het
Abca9 T A 11: 110,130,570 I1105F probably benign Het
Abr T C 11: 76,456,608 N396D possibly damaging Het
Aftph A C 11: 20,727,074 C178W probably damaging Het
Akr1c14 T C 13: 4,065,338 F89S possibly damaging Het
Ank3 C T 10: 69,986,206 A1518V probably benign Het
Arfgap2 T G 2: 91,267,368 S143R probably benign Het
Aspdh T A 7: 44,467,205 C107* probably null Het
Asphd2 C A 5: 112,391,746 G74W probably damaging Het
AU040320 G A 4: 126,854,466 probably null Het
B3glct T A 5: 149,725,402 probably null Het
Bcl9l A G 9: 44,506,803 K646R probably damaging Het
Brat1 T G 5: 140,718,296 L768R probably damaging Het
Btbd18 T A 2: 84,667,921 Y634* probably null Het
Bub1 T A 2: 127,823,938 probably benign Het
Carns1 A T 19: 4,166,418 D588E probably damaging Het
Cast T C 13: 74,746,047 K141E probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chsy3 T C 18: 59,175,800 S42P possibly damaging Het
Clca1 A T 3: 145,004,848 F865I possibly damaging Het
Clec4f T A 6: 83,645,282 M526L possibly damaging Het
Clnk T C 5: 38,720,913 E301G probably benign Het
Colgalt2 T A 1: 152,489,876 I309N probably benign Het
Cyp2e1 A T 7: 140,774,716 K326* probably null Het
Dagla T A 19: 10,250,394 T717S probably benign Het
Dnajc11 G A 4: 151,968,542 R141H probably benign Het
Dst A G 1: 34,191,884 K2853E probably benign Het
Eif4g1 A G 16: 20,686,515 K1208E possibly damaging Het
Elane A G 10: 79,886,791 R48G probably benign Het
Fbxo30 T A 10: 11,290,195 N220K probably benign Het
Fbxo33 A T 12: 59,200,928 probably benign Het
Fetub G A 16: 22,937,895 V169I probably benign Het
Gm13762 A G 2: 88,973,133 C253R probably damaging Het
Gm5861 T A 5: 11,186,491 Y138N probably damaging Het
Gpx6 A C 13: 21,317,064 Q107H probably damaging Het
Hist2h2bb A T 3: 96,269,151 probably benign Het
Homer3 A T 8: 70,285,434 I19F probably damaging Het
Hspa4 C T 11: 53,284,199 V144I probably benign Het
Icos C T 1: 60,993,717 S25L probably benign Het
Ifna4 A G 4: 88,841,948 T30A probably benign Het
Ino80b C T 6: 83,124,750 G46D probably damaging Het
Kpna2 T G 11: 106,992,664 I100L possibly damaging Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
Krtap31-2 A G 11: 99,936,576 N78S possibly damaging Het
Lman1 A G 18: 65,998,434 S132P probably benign Het
Lmna T C 3: 88,486,533 Q246R possibly damaging Het
Lrp10 T A 14: 54,468,592 V413E probably damaging Het
Macf1 A C 4: 123,471,650 I1541S probably benign Het
Med24 A G 11: 98,706,432 L874P probably damaging Het
Mgll T A 6: 88,725,111 probably benign Het
Mrpl37 A T 4: 107,057,475 L364Q probably damaging Het
Mrpl47 C T 3: 32,728,441 R209H probably benign Het
Muc5ac T C 7: 141,817,601 F3285L probably benign Het
Mylk A G 16: 34,879,169 R301G probably benign Het
Nacad A G 11: 6,605,726 L8P unknown Het
Ncf1 T A 5: 134,229,545 H8L probably damaging Het
Ncoa3 T A 2: 166,069,903 M1383K possibly damaging Het
Necab2 C T 8: 119,467,598 S271L probably benign Het
Nme8 A T 13: 19,675,638 probably null Het
Nsrp1 T G 11: 77,076,719 T16P possibly damaging Het
Obox3 A T 7: 15,625,692 probably null Het
Olfr1211 T A 2: 88,929,914 I134F probably damaging Het
Olfr1416 C A 1: 92,479,983 A213S probably benign Het
Olfr1428 T A 19: 12,109,177 Y123F probably damaging Het
Olfr355 T C 2: 36,927,583 H177R probably damaging Het
Olfr667 A T 7: 104,916,410 Y295* probably null Het
Osbpl3 C G 6: 50,300,997 E790Q possibly damaging Het
Osmr A T 15: 6,842,852 W254R probably damaging Het
Otoa T C 7: 121,132,924 probably benign Het
Pagr1a A T 7: 127,015,379 L218H probably damaging Het
Pcdha11 G A 18: 37,006,944 G542D probably damaging Het
Pck2 T A 14: 55,542,561 I54N probably damaging Het
Ppif T C 14: 25,699,499 V173A probably damaging Het
Ptgs2 T A 1: 150,104,020 L292H probably damaging Het
Ptpru A G 4: 131,802,586 S604P probably damaging Het
Qrfpr T C 3: 36,182,622 H210R possibly damaging Het
Rasgrf1 A G 9: 89,910,118 T41A probably damaging Het
Rasgrf1 A G 9: 90,012,866 H1113R probably damaging Het
Rhoc T A 3: 104,792,647 I80N probably damaging Het
Riok3 A G 18: 12,153,983 N472S probably benign Het
Rnf213 A G 11: 119,445,745 Y3314C probably benign Het
Shank2 C T 7: 144,409,468 T264I probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 A G 12: 82,341,194 I65V probably benign Het
Slc22a19 T C 19: 7,691,145 K291R possibly damaging Het
Slc22a20 T C 19: 5,980,460 I315V probably benign Het
Slc44a1 A T 4: 53,560,973 D563V probably damaging Het
Smchd1 A T 17: 71,391,468 H1104Q probably benign Het
Spcs2 A T 7: 99,844,769 probably null Het
Sptb T C 12: 76,627,110 E301G probably benign Het
Stum T C 1: 180,442,669 D86G probably damaging Het
Sufu A T 19: 46,483,649 D449V probably benign Het
Sun5 T C 2: 153,866,016 probably null Het
Tbc1d15 T A 10: 115,202,587 I574F probably damaging Het
Tert G A 13: 73,628,063 S311N possibly damaging Het
Tiparp T C 3: 65,552,804 Y507H probably damaging Het
Tnk2 T C 16: 32,679,857 C158R probably damaging Het
Tpgs1 T C 10: 79,675,620 S199P possibly damaging Het
Trdmt1 G T 2: 13,544,653 probably benign Het
Trp53bp1 T A 2: 121,227,809 D944V probably damaging Het
Tsc1 T A 2: 28,679,081 I720N probably damaging Het
Ttn T C 2: 76,709,605 T34346A probably benign Het
Ttn T C 2: 76,897,581 probably benign Het
Uba7 T A 9: 107,979,805 C686S possibly damaging Het
Ush2a T A 1: 188,850,087 F3782L probably damaging Het
Vars2 A T 17: 35,659,343 H745Q possibly damaging Het
Vmn2r15 T C 5: 109,286,754 M695V probably benign Het
Vps41 A T 13: 18,811,622 D208V probably damaging Het
Vta1 C T 10: 14,655,816 A272T probably benign Het
Wnk4 G A 11: 101,276,362 probably benign Het
Zfp507 T C 7: 35,794,382 K412R probably damaging Het
Zfp768 A G 7: 127,344,762 F65L possibly damaging Het
Zfp956 T C 6: 47,963,576 S290P probably benign Het
Other mutations in Vgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Vgf UTSW 5 137031482 unclassified probably benign
R1832:Vgf UTSW 5 137031299 missense possibly damaging 0.46
R1960:Vgf UTSW 5 137032175 unclassified probably benign
R2256:Vgf UTSW 5 137031547 unclassified probably benign
R3433:Vgf UTSW 5 137031019 missense probably benign 0.27
R5304:Vgf UTSW 5 137032286 missense probably damaging 0.96
R6874:Vgf UTSW 5 137031532 unclassified probably benign
R6944:Vgf UTSW 5 137032352 missense probably damaging 0.99
R6969:Vgf UTSW 5 137031653 unclassified probably benign
R7499:Vgf UTSW 5 137032245 missense probably damaging 0.99
R7511:Vgf UTSW 5 137031391 missense unknown
R7791:Vgf UTSW 5 137032031 missense unknown
R8356:Vgf UTSW 5 137032411 missense probably damaging 0.97
R8456:Vgf UTSW 5 137032411 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCAGTATCTGTTGCAGGGC -3'
(R):5'- CGGCCGAATGTAGTTTGGGAAG -3'

Sequencing Primer
(F):5'- AGAACGCACTCCTGTTCG -3'
(R):5'- GGGGAAACACCTCATCCTC -3'
Posted On2015-11-11