Incidental Mutation 'R4751:Rasgrf1'
ID357605
Institutional Source Beutler Lab
Gene Symbol Rasgrf1
Ensembl Gene ENSMUSG00000032356
Gene NameRAS protein-specific guanine nucleotide-releasing factor 1
SynonymsCDC25, Grfbeta, CDC25Mm, Grf1
MMRRC Submission 041970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4751 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location89909908-90026977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89910118 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 41 (T41A)
Ref Sequence ENSEMBL: ENSMUSP00000034912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034909] [ENSMUST00000034912] [ENSMUST00000189545]
PDB Structure
Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034909
AA Change: T41A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034909
Gene: ENSMUSG00000032356
AA Change: T41A

DomainStartEndE-ValueType
PH 23 143 1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000034912
AA Change: T41A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356
AA Change: T41A

DomainStartEndE-ValueType
PH 23 132 2.48e-18 SMART
Blast:RhoGEF 146 196 4e-6 BLAST
IQ 205 227 5.27e0 SMART
RhoGEF 248 429 1.96e-57 SMART
PH 461 590 1.51e-8 SMART
RasGEFN 634 767 3.07e-10 SMART
low complexity region 844 855 N/A INTRINSIC
RasGEFN 869 997 5.86e-7 SMART
RasGEF 1023 1260 1.85e-99 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189545
AA Change: T41A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140921
Gene: ENSMUSG00000032356
AA Change: T41A

DomainStartEndE-ValueType
PH 23 143 3.1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190073
Meta Mutation Damage Score 0.0673 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (124/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A T 7: 128,237,086 C112S probably benign Het
Abca13 G A 11: 9,277,973 probably null Het
Abca14 A G 7: 120,312,177 E1328G probably benign Het
Abca9 T A 11: 110,130,570 I1105F probably benign Het
Abr T C 11: 76,456,608 N396D possibly damaging Het
Aftph A C 11: 20,727,074 C178W probably damaging Het
Akr1c14 T C 13: 4,065,338 F89S possibly damaging Het
Ank3 C T 10: 69,986,206 A1518V probably benign Het
Arfgap2 T G 2: 91,267,368 S143R probably benign Het
Aspdh T A 7: 44,467,205 C107* probably null Het
Asphd2 C A 5: 112,391,746 G74W probably damaging Het
AU040320 G A 4: 126,854,466 probably null Het
B3glct T A 5: 149,725,402 probably null Het
Bcl9l A G 9: 44,506,803 K646R probably damaging Het
Brat1 T G 5: 140,718,296 L768R probably damaging Het
Btbd18 T A 2: 84,667,921 Y634* probably null Het
Bub1 T A 2: 127,823,938 probably benign Het
Carns1 A T 19: 4,166,418 D588E probably damaging Het
Cast T C 13: 74,746,047 K141E probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chsy3 T C 18: 59,175,800 S42P possibly damaging Het
Clca1 A T 3: 145,004,848 F865I possibly damaging Het
Clec4f T A 6: 83,645,282 M526L possibly damaging Het
Clnk T C 5: 38,720,913 E301G probably benign Het
Colgalt2 T A 1: 152,489,876 I309N probably benign Het
Cyp2e1 A T 7: 140,774,716 K326* probably null Het
Dagla T A 19: 10,250,394 T717S probably benign Het
Dnajc11 G A 4: 151,968,542 R141H probably benign Het
Dst A G 1: 34,191,884 K2853E probably benign Het
Eif4g1 A G 16: 20,686,515 K1208E possibly damaging Het
Elane A G 10: 79,886,791 R48G probably benign Het
Fbxo30 T A 10: 11,290,195 N220K probably benign Het
Fbxo33 A T 12: 59,200,928 probably benign Het
Fetub G A 16: 22,937,895 V169I probably benign Het
Gm13762 A G 2: 88,973,133 C253R probably damaging Het
Gm5861 T A 5: 11,186,491 Y138N probably damaging Het
Gpx6 A C 13: 21,317,064 Q107H probably damaging Het
Hist2h2bb A T 3: 96,269,151 probably benign Het
Homer3 A T 8: 70,285,434 I19F probably damaging Het
Hspa4 C T 11: 53,284,199 V144I probably benign Het
Icos C T 1: 60,993,717 S25L probably benign Het
Ifna4 A G 4: 88,841,948 T30A probably benign Het
Ino80b C T 6: 83,124,750 G46D probably damaging Het
Kpna2 T G 11: 106,992,664 I100L possibly damaging Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
Krtap31-2 A G 11: 99,936,576 N78S possibly damaging Het
Lman1 A G 18: 65,998,434 S132P probably benign Het
Lmna T C 3: 88,486,533 Q246R possibly damaging Het
Lrp10 T A 14: 54,468,592 V413E probably damaging Het
Macf1 A C 4: 123,471,650 I1541S probably benign Het
Med24 A G 11: 98,706,432 L874P probably damaging Het
Mgll T A 6: 88,725,111 probably benign Het
Mrpl37 A T 4: 107,057,475 L364Q probably damaging Het
Mrpl47 C T 3: 32,728,441 R209H probably benign Het
Muc5ac T C 7: 141,817,601 F3285L probably benign Het
Mylk A G 16: 34,879,169 R301G probably benign Het
Nacad A G 11: 6,605,726 L8P unknown Het
Ncf1 T A 5: 134,229,545 H8L probably damaging Het
Ncoa3 T A 2: 166,069,903 M1383K possibly damaging Het
Necab2 C T 8: 119,467,598 S271L probably benign Het
Nme8 A T 13: 19,675,638 probably null Het
Nsrp1 T G 11: 77,076,719 T16P possibly damaging Het
Obox3 A T 7: 15,625,692 probably null Het
Olfr1211 T A 2: 88,929,914 I134F probably damaging Het
Olfr1416 C A 1: 92,479,983 A213S probably benign Het
Olfr1428 T A 19: 12,109,177 Y123F probably damaging Het
Olfr355 T C 2: 36,927,583 H177R probably damaging Het
Olfr667 A T 7: 104,916,410 Y295* probably null Het
Osbpl3 C G 6: 50,300,997 E790Q possibly damaging Het
Osmr A T 15: 6,842,852 W254R probably damaging Het
Otoa T C 7: 121,132,924 probably benign Het
Pagr1a A T 7: 127,015,379 L218H probably damaging Het
Pcdha11 G A 18: 37,006,944 G542D probably damaging Het
Pck2 T A 14: 55,542,561 I54N probably damaging Het
Ppif T C 14: 25,699,499 V173A probably damaging Het
Ptgs2 T A 1: 150,104,020 L292H probably damaging Het
Ptpru A G 4: 131,802,586 S604P probably damaging Het
Qrfpr T C 3: 36,182,622 H210R possibly damaging Het
Rhoc T A 3: 104,792,647 I80N probably damaging Het
Riok3 A G 18: 12,153,983 N472S probably benign Het
Rnf213 A G 11: 119,445,745 Y3314C probably benign Het
Shank2 C T 7: 144,409,468 T264I probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 A G 12: 82,341,194 I65V probably benign Het
Slc22a19 T C 19: 7,691,145 K291R possibly damaging Het
Slc22a20 T C 19: 5,980,460 I315V probably benign Het
Slc44a1 A T 4: 53,560,973 D563V probably damaging Het
Smchd1 A T 17: 71,391,468 H1104Q probably benign Het
Spcs2 A T 7: 99,844,769 probably null Het
Sptb T C 12: 76,627,110 E301G probably benign Het
Stum T C 1: 180,442,669 D86G probably damaging Het
Sufu A T 19: 46,483,649 D449V probably benign Het
Sun5 T C 2: 153,866,016 probably null Het
Tbc1d15 T A 10: 115,202,587 I574F probably damaging Het
Tert G A 13: 73,628,063 S311N possibly damaging Het
Tiparp T C 3: 65,552,804 Y507H probably damaging Het
Tnk2 T C 16: 32,679,857 C158R probably damaging Het
Tpgs1 T C 10: 79,675,620 S199P possibly damaging Het
Trdmt1 G T 2: 13,544,653 probably benign Het
Trp53bp1 T A 2: 121,227,809 D944V probably damaging Het
Tsc1 T A 2: 28,679,081 I720N probably damaging Het
Ttn T C 2: 76,709,605 T34346A probably benign Het
Ttn T C 2: 76,897,581 probably benign Het
Uba7 T A 9: 107,979,805 C686S possibly damaging Het
Ush2a T A 1: 188,850,087 F3782L probably damaging Het
Vars2 A T 17: 35,659,343 H745Q possibly damaging Het
Vgf T A 5: 137,032,401 D472E probably damaging Het
Vmn2r15 T C 5: 109,286,754 M695V probably benign Het
Vps41 A T 13: 18,811,622 D208V probably damaging Het
Vta1 C T 10: 14,655,816 A272T probably benign Het
Wnk4 G A 11: 101,276,362 probably benign Het
Zfp507 T C 7: 35,794,382 K412R probably damaging Het
Zfp768 A G 7: 127,344,762 F65L possibly damaging Het
Zfp956 T C 6: 47,963,576 S290P probably benign Het
Other mutations in Rasgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Rasgrf1 APN 9 89970481 missense probably damaging 1.00
IGL00763:Rasgrf1 APN 9 89971020 missense probably benign 0.05
IGL01336:Rasgrf1 APN 9 89991530 missense probably benign 0.00
IGL01710:Rasgrf1 APN 9 89991692 missense probably benign 0.18
IGL01807:Rasgrf1 APN 9 89991513 missense probably damaging 0.99
IGL01939:Rasgrf1 APN 9 89974836 missense probably damaging 0.99
IGL02453:Rasgrf1 APN 9 89944760 missense possibly damaging 0.76
IGL02961:Rasgrf1 APN 9 89981649 missense possibly damaging 0.88
IGL03009:Rasgrf1 APN 9 89991703 missense possibly damaging 0.75
IGL03369:Rasgrf1 APN 9 90010451 missense probably damaging 1.00
IGL03373:Rasgrf1 APN 9 90017031 splice site probably benign
Malenkiy UTSW 9 90010484 splice site probably null
PIT4142001:Rasgrf1 UTSW 9 89915573 missense possibly damaging 0.91
R0234:Rasgrf1 UTSW 9 90009366 missense probably damaging 1.00
R0629:Rasgrf1 UTSW 9 89984269 missense probably damaging 1.00
R0685:Rasgrf1 UTSW 9 89915482 utr 3 prime probably benign
R0730:Rasgrf1 UTSW 9 89951009 splice site probably benign
R0835:Rasgrf1 UTSW 9 90000771 missense probably benign
R1432:Rasgrf1 UTSW 9 90012800 missense probably benign 0.35
R1647:Rasgrf1 UTSW 9 89953920 missense probably benign 0.28
R1717:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1933:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1934:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R2187:Rasgrf1 UTSW 9 89994835 missense possibly damaging 0.93
R2240:Rasgrf1 UTSW 9 89976762 missense probably damaging 0.99
R2940:Rasgrf1 UTSW 9 89991714 missense possibly damaging 0.84
R3949:Rasgrf1 UTSW 9 89981744 splice site probably benign
R4751:Rasgrf1 UTSW 9 90012866 missense probably damaging 1.00
R4901:Rasgrf1 UTSW 9 89995003 missense probably benign 0.00
R4910:Rasgrf1 UTSW 9 89976752 missense probably benign 0.00
R4961:Rasgrf1 UTSW 9 89944869 missense probably benign 0.06
R5270:Rasgrf1 UTSW 9 90026694 missense probably benign 0.00
R5320:Rasgrf1 UTSW 9 90020425 missense probably damaging 0.99
R5602:Rasgrf1 UTSW 9 89911571 missense possibly damaging 0.73
R5659:Rasgrf1 UTSW 9 89984289 missense probably damaging 1.00
R5960:Rasgrf1 UTSW 9 90021384 missense possibly damaging 0.69
R6074:Rasgrf1 UTSW 9 89953915 missense probably benign 0.01
R6400:Rasgrf1 UTSW 9 89991630 missense probably damaging 1.00
R6596:Rasgrf1 UTSW 9 90012794 missense possibly damaging 0.92
R6603:Rasgrf1 UTSW 9 89910257 missense probably damaging 0.96
R6647:Rasgrf1 UTSW 9 90010463 missense probably benign 0.00
R6813:Rasgrf1 UTSW 9 90010484 splice site probably null
R7136:Rasgrf1 UTSW 9 89991598 missense probably damaging 1.00
R7155:Rasgrf1 UTSW 9 90002361 missense possibly damaging 0.90
R7175:Rasgrf1 UTSW 9 89980749 missense probably benign 0.02
R7202:Rasgrf1 UTSW 9 90017072 missense possibly damaging 0.49
R7219:Rasgrf1 UTSW 9 89984288 missense probably damaging 1.00
R7244:Rasgrf1 UTSW 9 89994757 missense probably damaging 1.00
R7733:Rasgrf1 UTSW 9 89981727 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCCTCTCTGAGATGTAAGTGC -3'
(R):5'- TCCCCAAAGCTGGATGGAAG -3'

Sequencing Primer
(F):5'- CGTAGCAGTCTCTCAGGCC -3'
(R):5'- CCTCAAAGGCCTTAGCAGG -3'
Posted On2015-11-11