Incidental Mutation 'R4751:Kpna2'
ID357622
Institutional Source Beutler Lab
Gene Symbol Kpna2
Ensembl Gene ENSMUSG00000018362
Gene Namekaryopherin (importin) alpha 2
Synonyms2410044B12Rik, pendulin, m-importin-alpha-P1, m-importin, Rch1, Importin alpha
MMRRC Submission 041970-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R4751 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106988629-106999541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 106992664 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 100 (I100L)
Ref Sequence ENSEMBL: ENSMUSP00000118679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018506] [ENSMUST00000106768] [ENSMUST00000124541] [ENSMUST00000140362] [ENSMUST00000144834] [ENSMUST00000145331]
Predicted Effect probably benign
Transcript: ENSMUST00000018506
AA Change: I81L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000018506
Gene: ENSMUSG00000018362
AA Change: I81L

DomainStartEndE-ValueType
Pfam:IBB 9 98 2.8e-32 PFAM
ARM 108 149 8.95e-7 SMART
ARM 151 191 1.33e-9 SMART
ARM 193 231 2.7e-1 SMART
ARM 241 280 1.74e-4 SMART
ARM 282 322 1.92e-6 SMART
ARM 324 364 2.76e-7 SMART
ARM 366 406 3.45e-8 SMART
ARM 409 449 2.17e-5 SMART
Pfam:Arm_3 458 509 3.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106768
SMART Domains Protein: ENSMUSP00000102379
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 79 4.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124541
AA Change: I81L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114636
Gene: ENSMUSG00000018362
AA Change: I81L

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.7e-29 PFAM
Pfam:Arm 108 149 4.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140362
AA Change: I100L

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118679
Gene: ENSMUSG00000018362
AA Change: I100L

DomainStartEndE-ValueType
Pfam:IBB 24 118 9.7e-30 PFAM
Pfam:Arm 127 168 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144834
AA Change: I81L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121655
Gene: ENSMUSG00000018362
AA Change: I81L

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.1e-29 PFAM
Pfam:Arm 108 149 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145331
SMART Domains Protein: ENSMUSP00000122983
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 74 1.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156495
Meta Mutation Damage Score 0.2211 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (124/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The import of proteins into the nucleus is a process that involves at least 2 steps. The first is an energy-independent docking of the protein to the nuclear envelope and the second is an energy-dependent translocation through the nuclear pore complex. Imported proteins require a nuclear localization sequence (NLS) which generally consists of a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart. Proteins involved in the first step of nuclear import have been identified in different systems. These include the Xenopus protein importin and its yeast homolog, SRP1 (a suppressor of certain temperature-sensitive mutations of RNA polymerase I in Saccharomyces cerevisiae), which bind to the NLS. KPNA2 protein interacts with the NLSs of DNA helicase Q1 and SV40 T antigen and may be involved in the nuclear transport of proteins. KPNA2 also may play a role in V(D)J recombination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A T 7: 128,237,086 C112S probably benign Het
Abca13 G A 11: 9,277,973 probably null Het
Abca14 A G 7: 120,312,177 E1328G probably benign Het
Abca9 T A 11: 110,130,570 I1105F probably benign Het
Abr T C 11: 76,456,608 N396D possibly damaging Het
Aftph A C 11: 20,727,074 C178W probably damaging Het
Akr1c14 T C 13: 4,065,338 F89S possibly damaging Het
Ank3 C T 10: 69,986,206 A1518V probably benign Het
Arfgap2 T G 2: 91,267,368 S143R probably benign Het
Aspdh T A 7: 44,467,205 C107* probably null Het
Asphd2 C A 5: 112,391,746 G74W probably damaging Het
AU040320 G A 4: 126,854,466 probably null Het
B3glct T A 5: 149,725,402 probably null Het
Bcl9l A G 9: 44,506,803 K646R probably damaging Het
Brat1 T G 5: 140,718,296 L768R probably damaging Het
Btbd18 T A 2: 84,667,921 Y634* probably null Het
Bub1 T A 2: 127,823,938 probably benign Het
Carns1 A T 19: 4,166,418 D588E probably damaging Het
Cast T C 13: 74,746,047 K141E probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chsy3 T C 18: 59,175,800 S42P possibly damaging Het
Clca1 A T 3: 145,004,848 F865I possibly damaging Het
Clec4f T A 6: 83,645,282 M526L possibly damaging Het
Clnk T C 5: 38,720,913 E301G probably benign Het
Colgalt2 T A 1: 152,489,876 I309N probably benign Het
Cyp2e1 A T 7: 140,774,716 K326* probably null Het
Dagla T A 19: 10,250,394 T717S probably benign Het
Dnajc11 G A 4: 151,968,542 R141H probably benign Het
Dst A G 1: 34,191,884 K2853E probably benign Het
Eif4g1 A G 16: 20,686,515 K1208E possibly damaging Het
Elane A G 10: 79,886,791 R48G probably benign Het
Fbxo30 T A 10: 11,290,195 N220K probably benign Het
Fbxo33 A T 12: 59,200,928 probably benign Het
Fetub G A 16: 22,937,895 V169I probably benign Het
Gm13762 A G 2: 88,973,133 C253R probably damaging Het
Gm5861 T A 5: 11,186,491 Y138N probably damaging Het
Gpx6 A C 13: 21,317,064 Q107H probably damaging Het
Hist2h2bb A T 3: 96,269,151 probably benign Het
Homer3 A T 8: 70,285,434 I19F probably damaging Het
Hspa4 C T 11: 53,284,199 V144I probably benign Het
Icos C T 1: 60,993,717 S25L probably benign Het
Ifna4 A G 4: 88,841,948 T30A probably benign Het
Ino80b C T 6: 83,124,750 G46D probably damaging Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
Krtap31-2 A G 11: 99,936,576 N78S possibly damaging Het
Lman1 A G 18: 65,998,434 S132P probably benign Het
Lmna T C 3: 88,486,533 Q246R possibly damaging Het
Lrp10 T A 14: 54,468,592 V413E probably damaging Het
Macf1 A C 4: 123,471,650 I1541S probably benign Het
Med24 A G 11: 98,706,432 L874P probably damaging Het
Mgll T A 6: 88,725,111 probably benign Het
Mrpl37 A T 4: 107,057,475 L364Q probably damaging Het
Mrpl47 C T 3: 32,728,441 R209H probably benign Het
Muc5ac T C 7: 141,817,601 F3285L probably benign Het
Mylk A G 16: 34,879,169 R301G probably benign Het
Nacad A G 11: 6,605,726 L8P unknown Het
Ncf1 T A 5: 134,229,545 H8L probably damaging Het
Ncoa3 T A 2: 166,069,903 M1383K possibly damaging Het
Necab2 C T 8: 119,467,598 S271L probably benign Het
Nme8 A T 13: 19,675,638 probably null Het
Nsrp1 T G 11: 77,076,719 T16P possibly damaging Het
Obox3 A T 7: 15,625,692 probably null Het
Olfr1211 T A 2: 88,929,914 I134F probably damaging Het
Olfr1416 C A 1: 92,479,983 A213S probably benign Het
Olfr1428 T A 19: 12,109,177 Y123F probably damaging Het
Olfr355 T C 2: 36,927,583 H177R probably damaging Het
Olfr667 A T 7: 104,916,410 Y295* probably null Het
Osbpl3 C G 6: 50,300,997 E790Q possibly damaging Het
Osmr A T 15: 6,842,852 W254R probably damaging Het
Otoa T C 7: 121,132,924 probably benign Het
Pagr1a A T 7: 127,015,379 L218H probably damaging Het
Pcdha11 G A 18: 37,006,944 G542D probably damaging Het
Pck2 T A 14: 55,542,561 I54N probably damaging Het
Ppif T C 14: 25,699,499 V173A probably damaging Het
Ptgs2 T A 1: 150,104,020 L292H probably damaging Het
Ptpru A G 4: 131,802,586 S604P probably damaging Het
Qrfpr T C 3: 36,182,622 H210R possibly damaging Het
Rasgrf1 A G 9: 89,910,118 T41A probably damaging Het
Rasgrf1 A G 9: 90,012,866 H1113R probably damaging Het
Rhoc T A 3: 104,792,647 I80N probably damaging Het
Riok3 A G 18: 12,153,983 N472S probably benign Het
Rnf213 A G 11: 119,445,745 Y3314C probably benign Het
Shank2 C T 7: 144,409,468 T264I probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 A G 12: 82,341,194 I65V probably benign Het
Slc22a19 T C 19: 7,691,145 K291R possibly damaging Het
Slc22a20 T C 19: 5,980,460 I315V probably benign Het
Slc44a1 A T 4: 53,560,973 D563V probably damaging Het
Smchd1 A T 17: 71,391,468 H1104Q probably benign Het
Spcs2 A T 7: 99,844,769 probably null Het
Sptb T C 12: 76,627,110 E301G probably benign Het
Stum T C 1: 180,442,669 D86G probably damaging Het
Sufu A T 19: 46,483,649 D449V probably benign Het
Sun5 T C 2: 153,866,016 probably null Het
Tbc1d15 T A 10: 115,202,587 I574F probably damaging Het
Tert G A 13: 73,628,063 S311N possibly damaging Het
Tiparp T C 3: 65,552,804 Y507H probably damaging Het
Tnk2 T C 16: 32,679,857 C158R probably damaging Het
Tpgs1 T C 10: 79,675,620 S199P possibly damaging Het
Trdmt1 G T 2: 13,544,653 probably benign Het
Trp53bp1 T A 2: 121,227,809 D944V probably damaging Het
Tsc1 T A 2: 28,679,081 I720N probably damaging Het
Ttn T C 2: 76,709,605 T34346A probably benign Het
Ttn T C 2: 76,897,581 probably benign Het
Uba7 T A 9: 107,979,805 C686S possibly damaging Het
Ush2a T A 1: 188,850,087 F3782L probably damaging Het
Vars2 A T 17: 35,659,343 H745Q possibly damaging Het
Vgf T A 5: 137,032,401 D472E probably damaging Het
Vmn2r15 T C 5: 109,286,754 M695V probably benign Het
Vps41 A T 13: 18,811,622 D208V probably damaging Het
Vta1 C T 10: 14,655,816 A272T probably benign Het
Wnk4 G A 11: 101,276,362 probably benign Het
Zfp507 T C 7: 35,794,382 K412R probably damaging Het
Zfp768 A G 7: 127,344,762 F65L possibly damaging Het
Zfp956 T C 6: 47,963,576 S290P probably benign Het
Other mutations in Kpna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Kpna2 APN 11 106991201 missense probably benign 0.01
IGL02985:Kpna2 APN 11 106989337 missense probably benign 0.11
R0016:Kpna2 UTSW 11 106991086 missense probably benign
R0233:Kpna2 UTSW 11 106992631 missense probably benign 0.03
R0359:Kpna2 UTSW 11 106991322 missense probably damaging 1.00
R1450:Kpna2 UTSW 11 106997309 missense probably benign 0.05
R1750:Kpna2 UTSW 11 106991445 missense probably damaging 0.99
R4762:Kpna2 UTSW 11 106990259 missense probably benign 0.04
R4911:Kpna2 UTSW 11 106990719 missense probably damaging 1.00
R4952:Kpna2 UTSW 11 106991235 missense probably damaging 1.00
R4976:Kpna2 UTSW 11 106991469 missense probably damaging 1.00
R5283:Kpna2 UTSW 11 106990832 missense probably damaging 1.00
R5564:Kpna2 UTSW 11 106990745 missense probably damaging 1.00
R6870:Kpna2 UTSW 11 106992694 splice site probably null
R7599:Kpna2 UTSW 11 106998757 missense probably null
R7606:Kpna2 UTSW 11 106992058 missense probably damaging 0.99
R7672:Kpna2 UTSW 11 106988963 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAATTCATGATTCTCCACTGCA -3'
(R):5'- CTTACAATGCCATGTGTGCTAGTGT -3'

Sequencing Primer
(F):5'- ATGATTCTCCACTGCACCTCC -3'
(R):5'- ATGGTGCTGCCCACATTAAG -3'
Posted On2015-11-11