Incidental Mutation 'R4752:Adamts17'
ID357675
Institutional Source Beutler Lab
Gene Symbol Adamts17
Ensembl Gene ENSMUSG00000058145
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
SynonymsAU023434
MMRRC Submission 042032-MU
Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4752 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location66839735-67153171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67004470 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 483 (T483A)
Ref Sequence ENSEMBL: ENSMUSP00000095984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]
Predicted Effect probably damaging
Transcript: ENSMUST00000098382
AA Change: T483A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: T483A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 179 2.9e-25 PFAM
Pfam:Reprolysin_5 228 422 3.1e-15 PFAM
Pfam:Reprolysin_2 248 440 6.1e-13 PFAM
Pfam:Reprolysin_3 252 398 2.2e-12 PFAM
Pfam:Reprolysin_4 328 446 7.1e-10 PFAM
Pfam:Reprolysin 334 450 2e-18 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 698 808 6.4e-30 PFAM
TSP1 829 887 1.81e-1 SMART
TSP1 889 942 1.15e-4 SMART
TSP1 949 993 4.05e-5 SMART
TSP1 1000 1054 2.91e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107478
AA Change: T483A

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: T483A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 180 3.1e-23 PFAM
Pfam:Reprolysin_5 228 424 3.2e-15 PFAM
Pfam:Reprolysin_2 248 440 5.9e-11 PFAM
Pfam:Reprolysin_3 252 398 6e-12 PFAM
Pfam:Reprolysin_4 328 446 6.8e-10 PFAM
Pfam:Reprolysin 334 450 4.3e-21 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 700 781 2.2e-16 PFAM
TSP1 802 860 1.81e-1 SMART
TSP1 862 915 1.15e-4 SMART
TSP1 922 966 4.05e-5 SMART
TSP1 973 1027 2.91e-6 SMART
Pfam:PLAC 1046 1080 1.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148538
Meta Mutation Damage Score 0.1163 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,069,990 Q1647K possibly damaging Het
Abcf3 A G 16: 20,550,576 E236G probably damaging Het
Ankrd26 G T 6: 118,540,465 P465Q probably null Het
Babam2 C T 5: 31,702,047 probably benign Het
Bpifb1 T A 2: 154,216,280 probably benign Het
Ccnb1ip1 T A 14: 50,793,665 T64S possibly damaging Het
Cdhr3 A G 12: 33,086,103 V46A probably damaging Het
Cep170 A T 1: 176,756,688 D708E probably benign Het
Cpsf6 A T 10: 117,361,368 probably benign Het
Cryzl2 C T 1: 157,458,649 probably null Het
Dgka A T 10: 128,736,659 F42I probably benign Het
Dip2a A T 10: 76,276,657 V1059E probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock4 T A 12: 40,446,365 I3K probably benign Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Eif2b4 G A 5: 31,191,231 R213* probably null Het
Eif3b A G 5: 140,441,101 D704G probably benign Het
Epn2 T C 11: 61,546,371 E125G probably damaging Het
F830016B08Rik A G 18: 60,301,081 N412S probably benign Het
Fbln2 A G 6: 91,256,243 M570V probably benign Het
Gm16686 A T 4: 88,755,488 probably benign Het
Hook2 C T 8: 85,002,720 Q632* probably null Het
Ipcef1 A T 10: 6,979,573 W56R probably damaging Het
Krt78 T C 15: 101,948,202 I418M probably benign Het
Limk1 G A 5: 134,670,441 T154I probably damaging Het
Lyl1 A T 8: 84,704,281 T271S probably benign Het
Megf6 A G 4: 154,252,438 I333V probably damaging Het
Meioc A G 11: 102,674,433 T236A probably benign Het
Nbas A G 12: 13,482,537 T1749A possibly damaging Het
Nfib T A 4: 82,296,779 Q529L probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nisch A T 14: 31,192,588 F42L probably damaging Het
Nomo1 T A 7: 46,057,202 Y547N probably damaging Het
Olfr1157 A G 2: 87,962,349 L181P probably damaging Het
Olfr1512 C T 14: 52,372,307 V249I probably damaging Het
Olfr538 T C 7: 140,574,602 S150P possibly damaging Het
Olfr919 T C 9: 38,697,970 Y136C probably damaging Het
Park2 T C 17: 12,004,123 S387P probably benign Het
Pcdh18 T A 3: 49,755,114 N117I probably damaging Het
Prl3c1 A T 13: 27,203,525 K164N probably benign Het
Prr23a3 T A 9: 98,865,647 L218Q probably damaging Het
Prss43 A G 9: 110,827,768 H114R possibly damaging Het
Ptcd3 A T 6: 71,901,312 M142K probably damaging Het
Shisa7 G A 7: 4,834,250 T89I possibly damaging Het
Slco1a1 C T 6: 141,946,614 A9T possibly damaging Het
Srcap C T 7: 127,559,000 probably benign Het
Tdg-ps G A 15: 82,516,371 noncoding transcript Het
Tgm4 A G 9: 123,051,386 D284G probably damaging Het
Tmc1 T A 19: 20,826,649 I355F probably benign Het
Tmem121b A T 6: 120,493,034 F241I possibly damaging Het
Tmem200c T A 17: 68,842,240 V606E probably benign Het
Ttc39c A G 18: 12,728,725 K370R probably benign Het
Vmn2r87 G A 10: 130,478,467 Q417* probably null Het
Vps45 T C 3: 96,048,387 Y97C possibly damaging Het
Zfp407 A G 18: 84,562,914 S25P probably benign Het
Zfp566 A G 7: 30,077,881 S292P probably damaging Het
Other mutations in Adamts17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Adamts17 APN 7 66968902 missense probably damaging 1.00
IGL00950:Adamts17 APN 7 67120912 missense possibly damaging 0.69
IGL01532:Adamts17 APN 7 66908601 missense probably damaging 1.00
IGL01591:Adamts17 APN 7 67004396 missense probably damaging 1.00
IGL01602:Adamts17 APN 7 66888411 missense probably benign 0.29
IGL01640:Adamts17 APN 7 67029680 missense probably damaging 0.98
IGL01686:Adamts17 APN 7 66840289 missense probably benign 0.06
IGL01747:Adamts17 APN 7 67052011 missense probably damaging 1.00
IGL02081:Adamts17 APN 7 67062110 missense probably damaging 1.00
IGL02152:Adamts17 APN 7 67125000 missense probably benign 0.01
IGL02264:Adamts17 APN 7 67047459 splice site probably null
IGL02457:Adamts17 APN 7 67027814 missense probably damaging 0.99
IGL02519:Adamts17 APN 7 67124973 missense possibly damaging 0.82
IGL02530:Adamts17 APN 7 66909376 missense probably damaging 1.00
IGL02649:Adamts17 APN 7 66849878 splice site probably benign
IGL02711:Adamts17 APN 7 67052040 splice site probably benign
IGL03006:Adamts17 APN 7 67078347 missense possibly damaging 0.53
IGL03203:Adamts17 APN 7 67062108 missense probably damaging 1.00
IGL03343:Adamts17 APN 7 67075316 missense probably damaging 1.00
E2594:Adamts17 UTSW 7 67004350 missense probably damaging 1.00
R0380:Adamts17 UTSW 7 67150044 missense probably benign 0.00
R0416:Adamts17 UTSW 7 66915898 splice site probably null
R0635:Adamts17 UTSW 7 66908605 missense probably damaging 1.00
R1083:Adamts17 UTSW 7 67147574 missense probably damaging 1.00
R1476:Adamts17 UTSW 7 67075343 missense probably damaging 1.00
R1728:Adamts17 UTSW 7 67149956 nonsense probably null
R1729:Adamts17 UTSW 7 67149956 nonsense probably null
R1763:Adamts17 UTSW 7 67147715 missense probably damaging 1.00
R1784:Adamts17 UTSW 7 67149956 nonsense probably null
R1905:Adamts17 UTSW 7 67047472 nonsense probably null
R1938:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3106:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3796:Adamts17 UTSW 7 66839914 splice site probably null
R3849:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R3850:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R3945:Adamts17 UTSW 7 67120939 missense probably benign
R4519:Adamts17 UTSW 7 66840566 missense probably damaging 0.99
R4554:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4555:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4556:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4557:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4700:Adamts17 UTSW 7 67041888 missense probably damaging 1.00
R5019:Adamts17 UTSW 7 67062070 nonsense probably null
R5438:Adamts17 UTSW 7 66888417 missense probably benign 0.30
R5444:Adamts17 UTSW 7 67041899 missense probably benign 0.02
R5673:Adamts17 UTSW 7 67041807 missense probably damaging 1.00
R6326:Adamts17 UTSW 7 67120888 missense probably benign 0.05
R6964:Adamts17 UTSW 7 66909400 missense possibly damaging 0.93
R6964:Adamts17 UTSW 7 67004353 missense probably benign 0.00
R7129:Adamts17 UTSW 7 67121010 missense probably damaging 1.00
R7317:Adamts17 UTSW 7 66840556 nonsense probably null
R7355:Adamts17 UTSW 7 67075304 missense
R7386:Adamts17 UTSW 7 66968849 missense probably benign 0.25
R7407:Adamts17 UTSW 7 67047556 nonsense probably null
R7432:Adamts17 UTSW 7 67051917 missense
R7782:Adamts17 UTSW 7 67125054 missense probably damaging 1.00
R7817:Adamts17 UTSW 7 66909476 missense probably damaging 0.99
X0022:Adamts17 UTSW 7 67041901 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CACATCCTTCTCAGAGGCTG -3'
(R):5'- TGCAAGTACCATGAGGATGTG -3'

Sequencing Primer
(F):5'- TTCTCAGAGGCTGAAAACTCAG -3'
(R):5'- GGATGTGTACACGGACACACC -3'
Posted On2015-11-11