Incidental Mutation 'R4752:Olfr538'
ID357677
Institutional Source Beutler Lab
Gene Symbol Olfr538
Ensembl Gene ENSMUSG00000095901
Gene Nameolfactory receptor 538
SynonymsMOR253-13P, MOR253-13P, GA_x6K02T2PBJ9-42723314-42724246, MOR253-10P, Olfr1553-ps1, MOR253-12P, Olfr1523-ps1, MOR253-12P
MMRRC Submission 042032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4752 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140567886-140575793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140574602 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 150 (S150P)
Ref Sequence ENSEMBL: ENSMUSP00000147315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084457] [ENSMUST00000210973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084457
AA Change: S150P

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081495
Gene: ENSMUSG00000095901
AA Change: S150P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.8e-6 PFAM
Pfam:7tm_1 41 290 2.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210973
AA Change: S150P

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,069,990 Q1647K possibly damaging Het
Abcf3 A G 16: 20,550,576 E236G probably damaging Het
Adamts17 A G 7: 67,004,470 T483A probably damaging Het
Ankrd26 G T 6: 118,540,465 P465Q probably null Het
Babam2 C T 5: 31,702,047 probably benign Het
Bpifb1 T A 2: 154,216,280 probably benign Het
Ccnb1ip1 T A 14: 50,793,665 T64S possibly damaging Het
Cdhr3 A G 12: 33,086,103 V46A probably damaging Het
Cep170 A T 1: 176,756,688 D708E probably benign Het
Cpsf6 A T 10: 117,361,368 probably benign Het
Cryzl2 C T 1: 157,458,649 probably null Het
Dgka A T 10: 128,736,659 F42I probably benign Het
Dip2a A T 10: 76,276,657 V1059E probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock4 T A 12: 40,446,365 I3K probably benign Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Eif2b4 G A 5: 31,191,231 R213* probably null Het
Eif3b A G 5: 140,441,101 D704G probably benign Het
Epn2 T C 11: 61,546,371 E125G probably damaging Het
F830016B08Rik A G 18: 60,301,081 N412S probably benign Het
Fbln2 A G 6: 91,256,243 M570V probably benign Het
Gm16686 A T 4: 88,755,488 probably benign Het
Hook2 C T 8: 85,002,720 Q632* probably null Het
Ipcef1 A T 10: 6,979,573 W56R probably damaging Het
Krt78 T C 15: 101,948,202 I418M probably benign Het
Limk1 G A 5: 134,670,441 T154I probably damaging Het
Lyl1 A T 8: 84,704,281 T271S probably benign Het
Megf6 A G 4: 154,252,438 I333V probably damaging Het
Meioc A G 11: 102,674,433 T236A probably benign Het
Nbas A G 12: 13,482,537 T1749A possibly damaging Het
Nfib T A 4: 82,296,779 Q529L probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nisch A T 14: 31,192,588 F42L probably damaging Het
Nomo1 T A 7: 46,057,202 Y547N probably damaging Het
Olfr1157 A G 2: 87,962,349 L181P probably damaging Het
Olfr1512 C T 14: 52,372,307 V249I probably damaging Het
Olfr919 T C 9: 38,697,970 Y136C probably damaging Het
Park2 T C 17: 12,004,123 S387P probably benign Het
Pcdh18 T A 3: 49,755,114 N117I probably damaging Het
Prl3c1 A T 13: 27,203,525 K164N probably benign Het
Prr23a3 T A 9: 98,865,647 L218Q probably damaging Het
Prss43 A G 9: 110,827,768 H114R possibly damaging Het
Ptcd3 A T 6: 71,901,312 M142K probably damaging Het
Shisa7 G A 7: 4,834,250 T89I possibly damaging Het
Slco1a1 C T 6: 141,946,614 A9T possibly damaging Het
Srcap C T 7: 127,559,000 probably benign Het
Tdg-ps G A 15: 82,516,371 noncoding transcript Het
Tgm4 A G 9: 123,051,386 D284G probably damaging Het
Tmc1 T A 19: 20,826,649 I355F probably benign Het
Tmem121b A T 6: 120,493,034 F241I possibly damaging Het
Tmem200c T A 17: 68,842,240 V606E probably benign Het
Ttc39c A G 18: 12,728,725 K370R probably benign Het
Vmn2r87 G A 10: 130,478,467 Q417* probably null Het
Vps45 T C 3: 96,048,387 Y97C possibly damaging Het
Zfp407 A G 18: 84,562,914 S25P probably benign Het
Zfp566 A G 7: 30,077,881 S292P probably damaging Het
Other mutations in Olfr538
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Olfr538 APN 7 140574770 missense possibly damaging 0.93
IGL02066:Olfr538 APN 7 140574500 missense possibly damaging 0.55
IGL02214:Olfr538 APN 7 140574557 nonsense probably null
IGL02466:Olfr538 APN 7 140574771 missense probably benign 0.01
IGL02534:Olfr538 APN 7 140574641 missense probably benign 0.00
R0631:Olfr538 UTSW 7 140574507 missense probably damaging 1.00
R0989:Olfr538 UTSW 7 140574287 missense probably damaging 0.99
R1470:Olfr538 UTSW 7 140574749 missense probably benign 0.02
R1470:Olfr538 UTSW 7 140574749 missense probably benign 0.02
R1533:Olfr538 UTSW 7 140575121 unclassified probably null
R1764:Olfr538 UTSW 7 140574470 missense probably damaging 0.97
R2184:Olfr538 UTSW 7 140574402 missense probably benign
R2513:Olfr538 UTSW 7 140574156 start codon destroyed probably null 0.97
R4445:Olfr538 UTSW 7 140574389 missense probably damaging 1.00
R4476:Olfr538 UTSW 7 140574929 missense probably damaging 1.00
R4607:Olfr538 UTSW 7 140574641 missense probably benign 0.02
R4608:Olfr538 UTSW 7 140574641 missense probably benign 0.02
R6934:Olfr538 UTSW 7 140574651 missense probably damaging 1.00
R6978:Olfr538 UTSW 7 140574287 missense probably damaging 0.99
R7559:Olfr538 UTSW 7 140574443 missense probably damaging 1.00
R7583:Olfr538 UTSW 7 140574210 missense probably benign 0.01
R7685:Olfr538 UTSW 7 140574246 missense probably damaging 1.00
Z1177:Olfr538 UTSW 7 140574956 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TTCAAAGGATGCATGGCCC -3'
(R):5'- GCAGGATGCTGGCAATGATG -3'

Sequencing Primer
(F):5'- GATGCATGGCCCAGCTCTTC -3'
(R):5'- TGATGCAGCCATAGGATAGC -3'
Posted On2015-11-11