Incidental Mutation 'R4752:Lyl1'
ID357678
Institutional Source Beutler Lab
Gene Symbol Lyl1
Ensembl Gene ENSMUSG00000034041
Gene Namelymphoblastomic leukemia 1
SynonymsLyl-1, bHLHa18
MMRRC Submission 042032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4752 (G1)
Quality Score209
Status Validated
Chromosome8
Chromosomal Location84701457-84704715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84704281 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 271 (T271S)
Ref Sequence ENSEMBL: ENSMUSP00000046010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000037165] [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000125370]
Predicted Effect probably benign
Transcript: ENSMUST00000001974
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037165
AA Change: T271S

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046010
Gene: ENSMUSG00000034041
AA Change: T271S

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
HLH 155 207 3.97e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076715
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099070
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109762
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109764
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109767
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109768
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125370
SMART Domains Protein: ENSMUSP00000135510
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 470 1.7e-140 PFAM
Pfam:Met_10 142 256 2.8e-8 PFAM
ZnF_C3H1 570 596 3.55e-6 SMART
low complexity region 619 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132236
Predicted Effect probably benign
Transcript: ENSMUST00000136423
SMART Domains Protein: ENSMUSP00000134723
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177260
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a basic helix-loop-helix transcription factor. The encoded protein may play roles in blood vessel maturation and hematopoeisis. A translocation between this locus and the T cell receptor beta locus (GeneID 6957) on chromosome 7 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice with mutation of this gene are vaible and fertile. Defects in production and differentiation of progenitor cells are observed, along with impaired ability of fetal liver or bone marrow cells in reconstituting B and T lineages after transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,069,990 Q1647K possibly damaging Het
Abcf3 A G 16: 20,550,576 E236G probably damaging Het
Adamts17 A G 7: 67,004,470 T483A probably damaging Het
Ankrd26 G T 6: 118,540,465 P465Q probably null Het
Babam2 C T 5: 31,702,047 probably benign Het
Bpifb1 T A 2: 154,216,280 probably benign Het
Ccnb1ip1 T A 14: 50,793,665 T64S possibly damaging Het
Cdhr3 A G 12: 33,086,103 V46A probably damaging Het
Cep170 A T 1: 176,756,688 D708E probably benign Het
Cpsf6 A T 10: 117,361,368 probably benign Het
Cryzl2 C T 1: 157,458,649 probably null Het
Dgka A T 10: 128,736,659 F42I probably benign Het
Dip2a A T 10: 76,276,657 V1059E probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock4 T A 12: 40,446,365 I3K probably benign Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Eif2b4 G A 5: 31,191,231 R213* probably null Het
Eif3b A G 5: 140,441,101 D704G probably benign Het
Epn2 T C 11: 61,546,371 E125G probably damaging Het
F830016B08Rik A G 18: 60,301,081 N412S probably benign Het
Fbln2 A G 6: 91,256,243 M570V probably benign Het
Gm16686 A T 4: 88,755,488 probably benign Het
Hook2 C T 8: 85,002,720 Q632* probably null Het
Ipcef1 A T 10: 6,979,573 W56R probably damaging Het
Krt78 T C 15: 101,948,202 I418M probably benign Het
Limk1 G A 5: 134,670,441 T154I probably damaging Het
Megf6 A G 4: 154,252,438 I333V probably damaging Het
Meioc A G 11: 102,674,433 T236A probably benign Het
Nbas A G 12: 13,482,537 T1749A possibly damaging Het
Nfib T A 4: 82,296,779 Q529L probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nisch A T 14: 31,192,588 F42L probably damaging Het
Nomo1 T A 7: 46,057,202 Y547N probably damaging Het
Olfr1157 A G 2: 87,962,349 L181P probably damaging Het
Olfr1512 C T 14: 52,372,307 V249I probably damaging Het
Olfr538 T C 7: 140,574,602 S150P possibly damaging Het
Olfr919 T C 9: 38,697,970 Y136C probably damaging Het
Park2 T C 17: 12,004,123 S387P probably benign Het
Pcdh18 T A 3: 49,755,114 N117I probably damaging Het
Prl3c1 A T 13: 27,203,525 K164N probably benign Het
Prr23a3 T A 9: 98,865,647 L218Q probably damaging Het
Prss43 A G 9: 110,827,768 H114R possibly damaging Het
Ptcd3 A T 6: 71,901,312 M142K probably damaging Het
Shisa7 G A 7: 4,834,250 T89I possibly damaging Het
Slco1a1 C T 6: 141,946,614 A9T possibly damaging Het
Srcap C T 7: 127,559,000 probably benign Het
Tdg-ps G A 15: 82,516,371 noncoding transcript Het
Tgm4 A G 9: 123,051,386 D284G probably damaging Het
Tmc1 T A 19: 20,826,649 I355F probably benign Het
Tmem121b A T 6: 120,493,034 F241I possibly damaging Het
Tmem200c T A 17: 68,842,240 V606E probably benign Het
Ttc39c A G 18: 12,728,725 K370R probably benign Het
Vmn2r87 G A 10: 130,478,467 Q417* probably null Het
Vps45 T C 3: 96,048,387 Y97C possibly damaging Het
Zfp407 A G 18: 84,562,914 S25P probably benign Het
Zfp566 A G 7: 30,077,881 S292P probably damaging Het
Other mutations in Lyl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Lyl1 APN 8 84702686 missense possibly damaging 0.46
IGL02948:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL02976:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03037:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03038:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03061:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03106:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03115:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03146:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03152:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03166:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03175:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03221:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03226:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03296:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03346:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03014:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
IGL03050:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
IGL03134:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
R3944:Lyl1 UTSW 8 84704002 missense probably damaging 1.00
R7508:Lyl1 UTSW 8 84704300 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATATAGGCTTCCTGGTGCGG -3'
(R):5'- AAAGCCACTGCAAGTAGCCTG -3'

Sequencing Primer
(F):5'- AAACGGCTGTGCTGACCTC -3'
(R):5'- CTGCAAGTAGCCTGTGGGAG -3'
Posted On2015-11-11