Incidental Mutation 'R4752:Dip2a'
ID357685
Institutional Source Beutler Lab
Gene Symbol Dip2a
Ensembl Gene ENSMUSG00000020231
Gene Namedisco interacting protein 2 homolog A
SynonymsKiaa0184-hp, 4931420H10Rik, Dip2
MMRRC Submission 042032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4752 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76259429-76345291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76276657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1059 (V1059E)
Ref Sequence ENSEMBL: ENSMUSP00000043710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048]
Predicted Effect probably damaging
Transcript: ENSMUST00000036033
AA Change: V1059E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: V1059E

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 4.3e-26 PFAM
Pfam:AMP-binding 982 1456 1.4e-52 PFAM
low complexity region 1487 1498 N/A INTRINSIC
low complexity region 1511 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105417
AA Change: V1069E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: V1069E

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 6.6e-28 PFAM
Pfam:AMP-binding 992 1466 7.3e-65 PFAM
low complexity region 1497 1508 N/A INTRINSIC
low complexity region 1521 1542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159807
Predicted Effect probably damaging
Transcript: ENSMUST00000160048
AA Change: V1020E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: V1020E

DomainStartEndE-ValueType
DMAP_binding 9 83 7.94e-23 SMART
low complexity region 134 169 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
Pfam:AMP-binding 291 767 5.3e-26 PFAM
Pfam:AMP-binding 943 1417 1.7e-52 PFAM
low complexity region 1448 1459 N/A INTRINSIC
low complexity region 1472 1493 N/A INTRINSIC
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,069,990 Q1647K possibly damaging Het
Abcf3 A G 16: 20,550,576 E236G probably damaging Het
Adamts17 A G 7: 67,004,470 T483A probably damaging Het
Ankrd26 G T 6: 118,540,465 P465Q probably null Het
Babam2 C T 5: 31,702,047 probably benign Het
Bpifb1 T A 2: 154,216,280 probably benign Het
Ccnb1ip1 T A 14: 50,793,665 T64S possibly damaging Het
Cdhr3 A G 12: 33,086,103 V46A probably damaging Het
Cep170 A T 1: 176,756,688 D708E probably benign Het
Cpsf6 A T 10: 117,361,368 probably benign Het
Cryzl2 C T 1: 157,458,649 probably null Het
Dgka A T 10: 128,736,659 F42I probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock4 T A 12: 40,446,365 I3K probably benign Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Eif2b4 G A 5: 31,191,231 R213* probably null Het
Eif3b A G 5: 140,441,101 D704G probably benign Het
Epn2 T C 11: 61,546,371 E125G probably damaging Het
F830016B08Rik A G 18: 60,301,081 N412S probably benign Het
Fbln2 A G 6: 91,256,243 M570V probably benign Het
Gm16686 A T 4: 88,755,488 probably benign Het
Hook2 C T 8: 85,002,720 Q632* probably null Het
Ipcef1 A T 10: 6,979,573 W56R probably damaging Het
Krt78 T C 15: 101,948,202 I418M probably benign Het
Limk1 G A 5: 134,670,441 T154I probably damaging Het
Lyl1 A T 8: 84,704,281 T271S probably benign Het
Megf6 A G 4: 154,252,438 I333V probably damaging Het
Meioc A G 11: 102,674,433 T236A probably benign Het
Nbas A G 12: 13,482,537 T1749A possibly damaging Het
Nfib T A 4: 82,296,779 Q529L probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nisch A T 14: 31,192,588 F42L probably damaging Het
Nomo1 T A 7: 46,057,202 Y547N probably damaging Het
Olfr1157 A G 2: 87,962,349 L181P probably damaging Het
Olfr1512 C T 14: 52,372,307 V249I probably damaging Het
Olfr538 T C 7: 140,574,602 S150P possibly damaging Het
Olfr919 T C 9: 38,697,970 Y136C probably damaging Het
Park2 T C 17: 12,004,123 S387P probably benign Het
Pcdh18 T A 3: 49,755,114 N117I probably damaging Het
Prl3c1 A T 13: 27,203,525 K164N probably benign Het
Prr23a3 T A 9: 98,865,647 L218Q probably damaging Het
Prss43 A G 9: 110,827,768 H114R possibly damaging Het
Ptcd3 A T 6: 71,901,312 M142K probably damaging Het
Shisa7 G A 7: 4,834,250 T89I possibly damaging Het
Slco1a1 C T 6: 141,946,614 A9T possibly damaging Het
Srcap C T 7: 127,559,000 probably benign Het
Tdg-ps G A 15: 82,516,371 noncoding transcript Het
Tgm4 A G 9: 123,051,386 D284G probably damaging Het
Tmc1 T A 19: 20,826,649 I355F probably benign Het
Tmem121b A T 6: 120,493,034 F241I possibly damaging Het
Tmem200c T A 17: 68,842,240 V606E probably benign Het
Ttc39c A G 18: 12,728,725 K370R probably benign Het
Vmn2r87 G A 10: 130,478,467 Q417* probably null Het
Vps45 T C 3: 96,048,387 Y97C possibly damaging Het
Zfp407 A G 18: 84,562,914 S25P probably benign Het
Zfp566 A G 7: 30,077,881 S292P probably damaging Het
Other mutations in Dip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dip2a APN 10 76313236 missense probably benign
IGL00849:Dip2a APN 10 76292318 missense probably damaging 0.99
IGL01685:Dip2a APN 10 76327749 missense probably damaging 1.00
IGL01825:Dip2a APN 10 76272680 nonsense probably null
IGL02343:Dip2a APN 10 76319478 missense probably benign 0.00
IGL02437:Dip2a APN 10 76298267 missense probably benign 0.09
IGL02981:Dip2a APN 10 76276421 missense possibly damaging 0.84
IGL03122:Dip2a APN 10 76275046 missense probably benign 0.00
IGL03261:Dip2a APN 10 76305148 missense possibly damaging 0.80
R0369:Dip2a UTSW 10 76298787 missense probably damaging 1.00
R0522:Dip2a UTSW 10 76321531 missense probably benign 0.03
R0962:Dip2a UTSW 10 76292432 unclassified probably benign
R1164:Dip2a UTSW 10 76276397 missense possibly damaging 0.72
R1309:Dip2a UTSW 10 76279776 missense probably damaging 1.00
R1426:Dip2a UTSW 10 76279820 unclassified probably benign
R1636:Dip2a UTSW 10 76321578 missense probably benign 0.01
R1823:Dip2a UTSW 10 76278502 nonsense probably null
R1830:Dip2a UTSW 10 76317963 missense probably damaging 1.00
R1876:Dip2a UTSW 10 76318091 missense probably damaging 1.00
R2284:Dip2a UTSW 10 76313193 missense probably benign 0.01
R2369:Dip2a UTSW 10 76313196 missense probably benign
R4050:Dip2a UTSW 10 76278607 missense probably damaging 1.00
R4089:Dip2a UTSW 10 76278489 splice site probably null
R4231:Dip2a UTSW 10 76319470 missense probably damaging 1.00
R4715:Dip2a UTSW 10 76296406 missense probably benign 0.34
R4846:Dip2a UTSW 10 76321493 missense probably damaging 1.00
R4849:Dip2a UTSW 10 76294533 missense probably damaging 1.00
R4892:Dip2a UTSW 10 76280759 missense probably benign 0.02
R4998:Dip2a UTSW 10 76319556 nonsense probably null
R5068:Dip2a UTSW 10 76318043 missense possibly damaging 0.82
R5141:Dip2a UTSW 10 76270453 missense probably damaging 1.00
R5253:Dip2a UTSW 10 76299997 missense probably damaging 1.00
R5304:Dip2a UTSW 10 76294523 missense possibly damaging 0.67
R5324:Dip2a UTSW 10 76296393 missense probably damaging 1.00
R5369:Dip2a UTSW 10 76292360 missense probably damaging 1.00
R6272:Dip2a UTSW 10 76286407 makesense probably null
R6884:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7143:Dip2a UTSW 10 76297791 missense probably damaging 1.00
R7247:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7252:Dip2a UTSW 10 76273202 missense not run
R7327:Dip2a UTSW 10 76272562 missense probably benign 0.41
R7334:Dip2a UTSW 10 76274246 missense possibly damaging 0.91
R7349:Dip2a UTSW 10 76285592 missense probably damaging 1.00
R7360:Dip2a UTSW 10 76278560 missense probably damaging 1.00
R7513:Dip2a UTSW 10 76313235 missense probably benign
Z1088:Dip2a UTSW 10 76285628 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCTAGCCCATCATCTCCATAC -3'
(R):5'- AGTGCCAGGTTTGGTAAACACC -3'

Sequencing Primer
(F):5'- TACAACCCTGCAGAGACCGTTC -3'
(R):5'- ATTTGGAGTTAGCCACACCG -3'
Posted On2015-11-11