Mutagenetix > Incidental Mutations

Incidental Mutation 'R4752:Krt78'

357699

Institutional Source

Beutler Lab

Gene Symbol

Krt78

Ensembl Gene

ENSMUSG00000050463

Gene Name

keratin 78

Synonyms

2310030B04Rik

MMRRC Submission

042032-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R4752 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101946001-101954287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101948202 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 418 (I418M)

Ref Sequence

ENSEMBL: ENSMUSP00000126197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164932]

Predicted Effect

probably benign
Transcript: ENSMUST00000164932
AA Change: I418M

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000126197
Gene: ENSMUSG00000050463
AA Change: I418M

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	2	101	5.7e-16	PFAM
Filament	104	417	1.38e-133	SMART
internal_repeat_1	421	660	8.87e-74	PROSPERO
internal_repeat_1	704	957	8.87e-74	PROSPERO
low complexity region	1033	1049	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	A	3: 138,069,990	Q1647K	possibly damaging	Het
Abcf3	A	G	16: 20,550,576	E236G	probably damaging	Het
Adamts17	A	G	7: 67,004,470	T483A	probably damaging	Het
Ankrd26	G	T	6: 118,540,465	P465Q	probably null	Het
Babam2	C	T	5: 31,702,047		probably benign	Het
Bpifb1	T	A	2: 154,216,280		probably benign	Het
Ccnb1ip1	T	A	14: 50,793,665	T64S	possibly damaging	Het
Cdhr3	A	G	12: 33,086,103	V46A	probably damaging	Het
Cep170	A	T	1: 176,756,688	D708E	probably benign	Het
Cpsf6	A	T	10: 117,361,368		probably benign	Het
Cryzl2	C	T	1: 157,458,649		probably null	Het
Dgka	A	T	10: 128,736,659	F42I	probably benign	Het
Dip2a	A	T	10: 76,276,657	V1059E	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dock4	T	A	12: 40,446,365	I3K	probably benign	Het
Dsc2	A	T	18: 20,038,222	N573K	probably damaging	Het
Eif2b4	G	A	5: 31,191,231	R213*	probably null	Het
Eif3b	A	G	5: 140,441,101	D704G	probably benign	Het
Epn2	T	C	11: 61,546,371	E125G	probably damaging	Het
F830016B08Rik	A	G	18: 60,301,081	N412S	probably benign	Het
Fbln2	A	G	6: 91,256,243	M570V	probably benign	Het
Gm16686	A	T	4: 88,755,488		probably benign	Het
Hook2	C	T	8: 85,002,720	Q632*	probably null	Het
Ipcef1	A	T	10: 6,979,573	W56R	probably damaging	Het
Limk1	G	A	5: 134,670,441	T154I	probably damaging	Het
Lyl1	A	T	8: 84,704,281	T271S	probably benign	Het
Megf6	A	G	4: 154,252,438	I333V	probably damaging	Het
Meioc	A	G	11: 102,674,433	T236A	probably benign	Het
Nbas	A	G	12: 13,482,537	T1749A	possibly damaging	Het
Nfib	T	A	4: 82,296,779	Q529L	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Nisch	A	T	14: 31,192,588	F42L	probably damaging	Het
Nomo1	T	A	7: 46,057,202	Y547N	probably damaging	Het
Olfr1157	A	G	2: 87,962,349	L181P	probably damaging	Het
Olfr1512	C	T	14: 52,372,307	V249I	probably damaging	Het
Olfr538	T	C	7: 140,574,602	S150P	possibly damaging	Het
Olfr919	T	C	9: 38,697,970	Y136C	probably damaging	Het
Park2	T	C	17: 12,004,123	S387P	probably benign	Het
Pcdh18	T	A	3: 49,755,114	N117I	probably damaging	Het
Prl3c1	A	T	13: 27,203,525	K164N	probably benign	Het
Prr23a3	T	A	9: 98,865,647	L218Q	probably damaging	Het
Prss43	A	G	9: 110,827,768	H114R	possibly damaging	Het
Ptcd3	A	T	6: 71,901,312	M142K	probably damaging	Het
Shisa7	G	A	7: 4,834,250	T89I	possibly damaging	Het
Slco1a1	C	T	6: 141,946,614	A9T	possibly damaging	Het
Srcap	C	T	7: 127,559,000		probably benign	Het
Tdg-ps	G	A	15: 82,516,371		noncoding transcript	Het
Tgm4	A	G	9: 123,051,386	D284G	probably damaging	Het
Tmc1	T	A	19: 20,826,649	I355F	probably benign	Het
Tmem121b	A	T	6: 120,493,034	F241I	possibly damaging	Het
Tmem200c	T	A	17: 68,842,240	V606E	probably benign	Het
Ttc39c	A	G	18: 12,728,725	K370R	probably benign	Het
Vmn2r87	G	A	10: 130,478,467	Q417*	probably null	Het
Vps45	T	C	3: 96,048,387	Y97C	possibly damaging	Het
Zfp407	A	G	18: 84,562,914	S25P	probably benign	Het
Zfp566	A	G	7: 30,077,881	S292P	probably damaging	Het

Other mutations in Krt78

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Krt78	APN	15	101947510	missense	probably benign	0.28
IGL01358:Krt78	APN	15	101946263	missense	probably benign	0.18
IGL01723:Krt78	APN	15	101951798	missense	possibly damaging	0.65
IGL01743:Krt78	APN	15	101950898	missense	probably benign	0.06
IGL01778:Krt78	APN	15	101950967	missense	probably damaging	1.00
IGL01792:Krt78	APN	15	101946650	missense	probably benign	0.01
IGL02271:Krt78	APN	15	101948593	missense	probably benign	0.02
IGL02481:Krt78	APN	15	101948418	splice site	probably benign
IGL02494:Krt78	APN	15	101954051	missense	probably benign	0.00
IGL02708:Krt78	APN	15	101953407	missense	possibly damaging	0.88
IGL02747:Krt78	APN	15	101950384	splice site	probably benign
IGL02997:Krt78	APN	15	101947163	missense	probably benign	0.11
IGL03350:Krt78	APN	15	101946517	missense	probably benign	0.02
IGL03410:Krt78	APN	15	101953986	missense	probably damaging	0.99
PIT4812001:Krt78	UTSW	15	101948069	missense	probably damaging	1.00
R0090:Krt78	UTSW	15	101947837	missense	probably benign	0.35
R0513:Krt78	UTSW	15	101950949	missense	probably damaging	1.00
R0908:Krt78	UTSW	15	101950901	missense	probably damaging	1.00
R1067:Krt78	UTSW	15	101946461	nonsense	probably null
R1070:Krt78	UTSW	15	101946293	missense	possibly damaging	0.86
R1194:Krt78	UTSW	15	101951786	missense	probably damaging	0.99
R1213:Krt78	UTSW	15	101951810	missense	probably benign	0.10
R1467:Krt78	UTSW	15	101946293	missense	possibly damaging	0.86
R1467:Krt78	UTSW	15	101946293	missense	possibly damaging	0.86
R1612:Krt78	UTSW	15	101951844	splice site	probably null
R1750:Krt78	UTSW	15	101946377	missense	probably benign	0.33
R1796:Krt78	UTSW	15	101950865	missense	probably damaging	1.00
R1863:Krt78	UTSW	15	101946569	missense	possibly damaging	0.53
R1901:Krt78	UTSW	15	101946963	nonsense	probably null
R1902:Krt78	UTSW	15	101946963	nonsense	probably null
R1975:Krt78	UTSW	15	101946168	makesense	probably null
R2105:Krt78	UTSW	15	101947414	missense	possibly damaging	0.93
R2418:Krt78	UTSW	15	101946634	missense	probably benign
R2421:Krt78	UTSW	15	101947264	missense	probably damaging	0.96
R2422:Krt78	UTSW	15	101947264	missense	probably damaging	0.96
R2443:Krt78	UTSW	15	101946598	missense	probably damaging	1.00
R2897:Krt78	UTSW	15	101947106	missense	probably benign
R4422:Krt78	UTSW	15	101947940	missense	probably benign	0.13
R4424:Krt78	UTSW	15	101947940	missense	probably benign	0.13
R4425:Krt78	UTSW	15	101947940	missense	probably benign	0.13
R4583:Krt78	UTSW	15	101946620	missense	possibly damaging	0.53
R4927:Krt78	UTSW	15	101946899	missense	probably benign	0.02
R5129:Krt78	UTSW	15	101947580	missense	possibly damaging	0.70
R5391:Krt78	UTSW	15	101951828	nonsense	probably null
R5575:Krt78	UTSW	15	101947352	nonsense	probably null
R5617:Krt78	UTSW	15	101947609	missense	probably damaging	0.99
R5806:Krt78	UTSW	15	101950502	missense	probably damaging	1.00
R5906:Krt78	UTSW	15	101948595	missense	probably damaging	0.98
R5993:Krt78	UTSW	15	101950449	missense	probably damaging	1.00
R6520:Krt78	UTSW	15	101951771	missense	probably benign	0.26
R6531:Krt78	UTSW	15	101952273	missense	probably benign	0.03
R6587:Krt78	UTSW	15	101952269	missense	probably benign	0.10
R6749:Krt78	UTSW	15	101950923	missense	probably damaging	1.00
R7126:Krt78	UTSW	15	101948436	missense	probably damaging	1.00
R7158:Krt78	UTSW	15	101951806	missense	probably benign	0.17
R7229:Krt78	UTSW	15	101947394	missense	probably benign	0.01
R7523:Krt78	UTSW	15	101946601	missense	not run
R7638:Krt78	UTSW	15	101950883	missense	probably damaging	1.00
X0018:Krt78	UTSW	15	101951800	missense	possibly damaging	0.96
Z1088:Krt78	UTSW	15	101947331	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TCCAGGCACAACTACTTGGC -3'
(R):5'- ATGTGGAGATCGCCATGTACC -3'

Sequencing Primer
(F):5'- AACTACTTGGCCTCCACAAGTTC -3'
(R):5'- AGCACCTGGGCTTAGGAG -3'

Posted On

2015-11-11