Incidental Mutation 'R4752:Krt78'
ID357699
Institutional Source Beutler Lab
Gene Symbol Krt78
Ensembl Gene ENSMUSG00000050463
Gene Namekeratin 78
Synonyms2310030B04Rik
MMRRC Submission 042032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4752 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101946001-101954287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101948202 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 418 (I418M)
Ref Sequence ENSEMBL: ENSMUSP00000126197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164932]
Predicted Effect probably benign
Transcript: ENSMUST00000164932
AA Change: I418M

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126197
Gene: ENSMUSG00000050463
AA Change: I418M

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 101 5.7e-16 PFAM
Filament 104 417 1.38e-133 SMART
internal_repeat_1 421 660 8.87e-74 PROSPERO
internal_repeat_1 704 957 8.87e-74 PROSPERO
low complexity region 1033 1049 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,069,990 Q1647K possibly damaging Het
Abcf3 A G 16: 20,550,576 E236G probably damaging Het
Adamts17 A G 7: 67,004,470 T483A probably damaging Het
Ankrd26 G T 6: 118,540,465 P465Q probably null Het
Babam2 C T 5: 31,702,047 probably benign Het
Bpifb1 T A 2: 154,216,280 probably benign Het
Ccnb1ip1 T A 14: 50,793,665 T64S possibly damaging Het
Cdhr3 A G 12: 33,086,103 V46A probably damaging Het
Cep170 A T 1: 176,756,688 D708E probably benign Het
Cpsf6 A T 10: 117,361,368 probably benign Het
Cryzl2 C T 1: 157,458,649 probably null Het
Dgka A T 10: 128,736,659 F42I probably benign Het
Dip2a A T 10: 76,276,657 V1059E probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock4 T A 12: 40,446,365 I3K probably benign Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Eif2b4 G A 5: 31,191,231 R213* probably null Het
Eif3b A G 5: 140,441,101 D704G probably benign Het
Epn2 T C 11: 61,546,371 E125G probably damaging Het
F830016B08Rik A G 18: 60,301,081 N412S probably benign Het
Fbln2 A G 6: 91,256,243 M570V probably benign Het
Gm16686 A T 4: 88,755,488 probably benign Het
Hook2 C T 8: 85,002,720 Q632* probably null Het
Ipcef1 A T 10: 6,979,573 W56R probably damaging Het
Limk1 G A 5: 134,670,441 T154I probably damaging Het
Lyl1 A T 8: 84,704,281 T271S probably benign Het
Megf6 A G 4: 154,252,438 I333V probably damaging Het
Meioc A G 11: 102,674,433 T236A probably benign Het
Nbas A G 12: 13,482,537 T1749A possibly damaging Het
Nfib T A 4: 82,296,779 Q529L probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nisch A T 14: 31,192,588 F42L probably damaging Het
Nomo1 T A 7: 46,057,202 Y547N probably damaging Het
Olfr1157 A G 2: 87,962,349 L181P probably damaging Het
Olfr1512 C T 14: 52,372,307 V249I probably damaging Het
Olfr538 T C 7: 140,574,602 S150P possibly damaging Het
Olfr919 T C 9: 38,697,970 Y136C probably damaging Het
Park2 T C 17: 12,004,123 S387P probably benign Het
Pcdh18 T A 3: 49,755,114 N117I probably damaging Het
Prl3c1 A T 13: 27,203,525 K164N probably benign Het
Prr23a3 T A 9: 98,865,647 L218Q probably damaging Het
Prss43 A G 9: 110,827,768 H114R possibly damaging Het
Ptcd3 A T 6: 71,901,312 M142K probably damaging Het
Shisa7 G A 7: 4,834,250 T89I possibly damaging Het
Slco1a1 C T 6: 141,946,614 A9T possibly damaging Het
Srcap C T 7: 127,559,000 probably benign Het
Tdg-ps G A 15: 82,516,371 noncoding transcript Het
Tgm4 A G 9: 123,051,386 D284G probably damaging Het
Tmc1 T A 19: 20,826,649 I355F probably benign Het
Tmem121b A T 6: 120,493,034 F241I possibly damaging Het
Tmem200c T A 17: 68,842,240 V606E probably benign Het
Ttc39c A G 18: 12,728,725 K370R probably benign Het
Vmn2r87 G A 10: 130,478,467 Q417* probably null Het
Vps45 T C 3: 96,048,387 Y97C possibly damaging Het
Zfp407 A G 18: 84,562,914 S25P probably benign Het
Zfp566 A G 7: 30,077,881 S292P probably damaging Het
Other mutations in Krt78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt78 APN 15 101947510 missense probably benign 0.28
IGL01358:Krt78 APN 15 101946263 missense probably benign 0.18
IGL01723:Krt78 APN 15 101951798 missense possibly damaging 0.65
IGL01743:Krt78 APN 15 101950898 missense probably benign 0.06
IGL01778:Krt78 APN 15 101950967 missense probably damaging 1.00
IGL01792:Krt78 APN 15 101946650 missense probably benign 0.01
IGL02271:Krt78 APN 15 101948593 missense probably benign 0.02
IGL02481:Krt78 APN 15 101948418 splice site probably benign
IGL02494:Krt78 APN 15 101954051 missense probably benign 0.00
IGL02708:Krt78 APN 15 101953407 missense possibly damaging 0.88
IGL02747:Krt78 APN 15 101950384 splice site probably benign
IGL02997:Krt78 APN 15 101947163 missense probably benign 0.11
IGL03350:Krt78 APN 15 101946517 missense probably benign 0.02
IGL03410:Krt78 APN 15 101953986 missense probably damaging 0.99
PIT4812001:Krt78 UTSW 15 101948069 missense probably damaging 1.00
R0090:Krt78 UTSW 15 101947837 missense probably benign 0.35
R0513:Krt78 UTSW 15 101950949 missense probably damaging 1.00
R0908:Krt78 UTSW 15 101950901 missense probably damaging 1.00
R1067:Krt78 UTSW 15 101946461 nonsense probably null
R1070:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1194:Krt78 UTSW 15 101951786 missense probably damaging 0.99
R1213:Krt78 UTSW 15 101951810 missense probably benign 0.10
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1612:Krt78 UTSW 15 101951844 splice site probably null
R1750:Krt78 UTSW 15 101946377 missense probably benign 0.33
R1796:Krt78 UTSW 15 101950865 missense probably damaging 1.00
R1863:Krt78 UTSW 15 101946569 missense possibly damaging 0.53
R1901:Krt78 UTSW 15 101946963 nonsense probably null
R1902:Krt78 UTSW 15 101946963 nonsense probably null
R1975:Krt78 UTSW 15 101946168 makesense probably null
R2105:Krt78 UTSW 15 101947414 missense possibly damaging 0.93
R2418:Krt78 UTSW 15 101946634 missense probably benign
R2421:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2422:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2443:Krt78 UTSW 15 101946598 missense probably damaging 1.00
R2897:Krt78 UTSW 15 101947106 missense probably benign
R4422:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4424:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4425:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4583:Krt78 UTSW 15 101946620 missense possibly damaging 0.53
R4927:Krt78 UTSW 15 101946899 missense probably benign 0.02
R5129:Krt78 UTSW 15 101947580 missense possibly damaging 0.70
R5391:Krt78 UTSW 15 101951828 nonsense probably null
R5575:Krt78 UTSW 15 101947352 nonsense probably null
R5617:Krt78 UTSW 15 101947609 missense probably damaging 0.99
R5806:Krt78 UTSW 15 101950502 missense probably damaging 1.00
R5906:Krt78 UTSW 15 101948595 missense probably damaging 0.98
R5993:Krt78 UTSW 15 101950449 missense probably damaging 1.00
R6520:Krt78 UTSW 15 101951771 missense probably benign 0.26
R6531:Krt78 UTSW 15 101952273 missense probably benign 0.03
R6587:Krt78 UTSW 15 101952269 missense probably benign 0.10
R6749:Krt78 UTSW 15 101950923 missense probably damaging 1.00
R7126:Krt78 UTSW 15 101948436 missense probably damaging 1.00
R7158:Krt78 UTSW 15 101951806 missense probably benign 0.17
R7229:Krt78 UTSW 15 101947394 missense probably benign 0.01
R7523:Krt78 UTSW 15 101946601 missense not run
R7638:Krt78 UTSW 15 101950883 missense probably damaging 1.00
X0018:Krt78 UTSW 15 101951800 missense possibly damaging 0.96
Z1088:Krt78 UTSW 15 101947331 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCCAGGCACAACTACTTGGC -3'
(R):5'- ATGTGGAGATCGCCATGTACC -3'

Sequencing Primer
(F):5'- AACTACTTGGCCTCCACAAGTTC -3'
(R):5'- AGCACCTGGGCTTAGGAG -3'
Posted On2015-11-11