Mutagenetix > Incidental Mutations

Incidental Mutation 'R4752:Dsc2'

357704

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

042032-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4752 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20038222 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 573 (N573K)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: N573K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: N573K

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: N573K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: N573K

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	A	3: 138,069,990	Q1647K	possibly damaging	Het
Abcf3	A	G	16: 20,550,576	E236G	probably damaging	Het
Adamts17	A	G	7: 67,004,470	T483A	probably damaging	Het
Ankrd26	G	T	6: 118,540,465	P465Q	probably null	Het
Babam2	C	T	5: 31,702,047		probably benign	Het
Bpifb1	T	A	2: 154,216,280		probably benign	Het
Ccnb1ip1	T	A	14: 50,793,665	T64S	possibly damaging	Het
Cdhr3	A	G	12: 33,086,103	V46A	probably damaging	Het
Cep170	A	T	1: 176,756,688	D708E	probably benign	Het
Cpsf6	A	T	10: 117,361,368		probably benign	Het
Cryzl2	C	T	1: 157,458,649		probably null	Het
Dgka	A	T	10: 128,736,659	F42I	probably benign	Het
Dip2a	A	T	10: 76,276,657	V1059E	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dock4	T	A	12: 40,446,365	I3K	probably benign	Het
Eif2b4	G	A	5: 31,191,231	R213*	probably null	Het
Eif3b	A	G	5: 140,441,101	D704G	probably benign	Het
Epn2	T	C	11: 61,546,371	E125G	probably damaging	Het
F830016B08Rik	A	G	18: 60,301,081	N412S	probably benign	Het
Fbln2	A	G	6: 91,256,243	M570V	probably benign	Het
Gm16686	A	T	4: 88,755,488		probably benign	Het
Hook2	C	T	8: 85,002,720	Q632*	probably null	Het
Ipcef1	A	T	10: 6,979,573	W56R	probably damaging	Het
Krt78	T	C	15: 101,948,202	I418M	probably benign	Het
Limk1	G	A	5: 134,670,441	T154I	probably damaging	Het
Lyl1	A	T	8: 84,704,281	T271S	probably benign	Het
Megf6	A	G	4: 154,252,438	I333V	probably damaging	Het
Meioc	A	G	11: 102,674,433	T236A	probably benign	Het
Nbas	A	G	12: 13,482,537	T1749A	possibly damaging	Het
Nfib	T	A	4: 82,296,779	Q529L	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Nisch	A	T	14: 31,192,588	F42L	probably damaging	Het
Nomo1	T	A	7: 46,057,202	Y547N	probably damaging	Het
Olfr1157	A	G	2: 87,962,349	L181P	probably damaging	Het
Olfr1512	C	T	14: 52,372,307	V249I	probably damaging	Het
Olfr538	T	C	7: 140,574,602	S150P	possibly damaging	Het
Olfr919	T	C	9: 38,697,970	Y136C	probably damaging	Het
Park2	T	C	17: 12,004,123	S387P	probably benign	Het
Pcdh18	T	A	3: 49,755,114	N117I	probably damaging	Het
Prl3c1	A	T	13: 27,203,525	K164N	probably benign	Het
Prr23a3	T	A	9: 98,865,647	L218Q	probably damaging	Het
Prss43	A	G	9: 110,827,768	H114R	possibly damaging	Het
Ptcd3	A	T	6: 71,901,312	M142K	probably damaging	Het
Shisa7	G	A	7: 4,834,250	T89I	possibly damaging	Het
Slco1a1	C	T	6: 141,946,614	A9T	possibly damaging	Het
Srcap	C	T	7: 127,559,000		probably benign	Het
Tdg-ps	G	A	15: 82,516,371		noncoding transcript	Het
Tgm4	A	G	9: 123,051,386	D284G	probably damaging	Het
Tmc1	T	A	19: 20,826,649	I355F	probably benign	Het
Tmem121b	A	T	6: 120,493,034	F241I	possibly damaging	Het
Tmem200c	T	A	17: 68,842,240	V606E	probably benign	Het
Ttc39c	A	G	18: 12,728,725	K370R	probably benign	Het
Vmn2r87	G	A	10: 130,478,467	Q417*	probably null	Het
Vps45	T	C	3: 96,048,387	Y97C	possibly damaging	Het
Zfp407	A	G	18: 84,562,914	S25P	probably benign	Het
Zfp566	A	G	7: 30,077,881	S292P	probably damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7935:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCGCATACCATTGATTCTTGTTAG -3'
(R):5'- TGCTGCCCACACTTTTAAGC -3'

Sequencing Primer
(F):5'- GTTAGCCTCCACATCCTCTGAAC -3'
(R):5'- CAGCGTTGTTGCTCATGAC -3'

Posted On

2015-11-11