Incidental Mutation 'R4753:Rad52'
ID357728
Institutional Source Beutler Lab
Gene Symbol Rad52
Ensembl Gene ENSMUSG00000030166
Gene NameRAD52 homolog, DNA repair protein
Synonyms
MMRRC Submission 041971-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R4753 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119902698-119922828 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 119912985 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032269] [ENSMUST00000161045] [ENSMUST00000162461]
Predicted Effect probably benign
Transcript: ENSMUST00000032269
SMART Domains Protein: ENSMUSP00000032269
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 185 2.4e-56 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160877
Predicted Effect probably benign
Transcript: ENSMUST00000161045
SMART Domains Protein: ENSMUSP00000125559
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
PDB:1H2I|V 1 64 2e-26 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162255
Predicted Effect probably benign
Transcript: ENSMUST00000162461
SMART Domains Protein: ENSMUSP00000125502
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 184 6.6e-51 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162590
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit normal reproductive and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dtl T C 1: 191,569,703 T81A probably damaging Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fam83g C A 11: 61,695,269 H228N probably damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Gcn1l1 T C 5: 115,616,478 V2379A probably benign Het
Grin2d G T 7: 45,833,906 P949Q probably damaging Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rasa1 A G 13: 85,288,390 probably null Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Slc6a12 C T 6: 121,356,903 probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Thnsl1 C T 2: 21,213,364 T122I probably damaging Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Zscan10 A C 17: 23,607,234 E123D probably damaging Het
Other mutations in Rad52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Rad52 APN 6 119918633 missense probably damaging 1.00
IGL02376:Rad52 APN 6 119915230 splice site probably benign
IGL02572:Rad52 APN 6 119915227 splice site probably benign
IGL03292:Rad52 APN 6 119918973 missense possibly damaging 0.96
R1693:Rad52 UTSW 6 119916035 missense probably damaging 1.00
R2076:Rad52 UTSW 6 119911079 missense probably benign 0.39
R2110:Rad52 UTSW 6 119920894 missense possibly damaging 0.80
R5857:Rad52 UTSW 6 119911007 intron probably null
R5866:Rad52 UTSW 6 119912946 intron probably benign
R6193:Rad52 UTSW 6 119920182 missense probably benign 0.03
R6369:Rad52 UTSW 6 119914207 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTATACATGAATGCCTAATCACCC -3'
(R):5'- GGGCCTCTGAGTCCATGAAATC -3'

Sequencing Primer
(F):5'- GACCTACTCAGCTCTACTCA -3'
(R):5'- CTGAGTCCATGAAATCTAGTAAAAGC -3'
Posted On2015-11-11