Incidental Mutation 'R4753:Slc6a12'
ID357729
Institutional Source Beutler Lab
Gene Symbol Slc6a12
Ensembl Gene ENSMUSG00000030109
Gene Namesolute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
SynonymsBGT1, Gabt2
MMRRC Submission 041971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4753 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121343076-121365775 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 121356903 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032200] [ENSMUST00000163771] [ENSMUST00000165456] [ENSMUST00000166390] [ENSMUST00000166457] [ENSMUST00000171008]
Predicted Effect probably benign
Transcript: ENSMUST00000032200
SMART Domains Protein: ENSMUSP00000032200
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 50 575 2e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163771
SMART Domains Protein: ENSMUSP00000127779
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 128 3.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165456
SMART Domains Protein: ENSMUSP00000130715
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 49 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166390
SMART Domains Protein: ENSMUSP00000128217
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
low complexity region 35 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166457
SMART Domains Protein: ENSMUSP00000126937
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 36 561 2.5e-242 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170582
Predicted Effect probably benign
Transcript: ENSMUST00000171008
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171874
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal seizure threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dtl T C 1: 191,569,703 T81A probably damaging Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fam83g C A 11: 61,695,269 H228N probably damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Gcn1l1 T C 5: 115,616,478 V2379A probably benign Het
Grin2d G T 7: 45,833,906 P949Q probably damaging Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rad52 T A 6: 119,912,985 probably benign Het
Rasa1 A G 13: 85,288,390 probably null Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Thnsl1 C T 2: 21,213,364 T122I probably damaging Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Zscan10 A C 17: 23,607,234 E123D probably damaging Het
Other mutations in Slc6a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Slc6a12 APN 6 121360455 missense probably damaging 1.00
IGL02066:Slc6a12 APN 6 121352056 missense probably damaging 0.97
IGL02146:Slc6a12 APN 6 121353501 missense probably benign 0.01
IGL02475:Slc6a12 APN 6 121354375 splice site probably null
IGL02498:Slc6a12 APN 6 121361070 missense probably benign
IGL02537:Slc6a12 APN 6 121360514 missense probably benign 0.00
IGL02696:Slc6a12 APN 6 121363252 missense probably benign 0.00
IGL03255:Slc6a12 APN 6 121354287 missense probably damaging 0.99
IGL03397:Slc6a12 APN 6 121357045 missense probably damaging 1.00
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0201:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0255:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0302:Slc6a12 UTSW 6 121363259 missense probably damaging 1.00
R0317:Slc6a12 UTSW 6 121358625 missense possibly damaging 0.80
R0394:Slc6a12 UTSW 6 121346998 critical splice donor site probably null
R0492:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0532:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0550:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0551:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R1421:Slc6a12 UTSW 6 121359126 missense probably damaging 1.00
R1487:Slc6a12 UTSW 6 121363757 nonsense probably null
R1879:Slc6a12 UTSW 6 121347423 missense probably damaging 1.00
R1905:Slc6a12 UTSW 6 121347443 nonsense probably null
R1925:Slc6a12 UTSW 6 121360526 missense probably benign 0.44
R3944:Slc6a12 UTSW 6 121354280 critical splice acceptor site probably null
R4515:Slc6a12 UTSW 6 121353530 critical splice donor site probably null
R4559:Slc6a12 UTSW 6 121363861 splice site probably null
R4628:Slc6a12 UTSW 6 121351992 nonsense probably null
R4665:Slc6a12 UTSW 6 121359013 splice site probably benign
R4948:Slc6a12 UTSW 6 121355322 missense probably benign 0.35
R5517:Slc6a12 UTSW 6 121354339 missense probably benign 0.10
R6717:Slc6a12 UTSW 6 121354303 missense probably benign 0.01
R7139:Slc6a12 UTSW 6 121365319 missense probably benign
R7318:Slc6a12 UTSW 6 121352013 missense probably damaging 0.99
R7318:Slc6a12 UTSW 6 121352019 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTCATACGCTCGCCATCAGC -3'
(R):5'- AAGGTACCTCCATTCACGTTTC -3'

Sequencing Primer
(F):5'- GCCATCAGCTGACTGTATGAAGTC -3'
(R):5'- GGTTCAGTATAAGTTCACAACACC -3'
Posted On2015-11-11