Incidental Mutation 'R4753:Grin2d'
ID357733
Institutional Source Beutler Lab
Gene Symbol Grin2d
Ensembl Gene ENSMUSG00000002771
Gene Nameglutamate receptor, ionotropic, NMDA2D (epsilon 4)
SynonymsNR2D, GluRepsilon4, NMDAR2D, GluN2D
MMRRC Submission 041971-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R4753 (G1)
Quality Score121
Status Validated
Chromosome7
Chromosomal Location45831883-45878378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45833906 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 949 (P949Q)
Ref Sequence ENSEMBL: ENSMUSP00000147663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002848] [ENSMUST00000107723] [ENSMUST00000131384] [ENSMUST00000209484] [ENSMUST00000211265] [ENSMUST00000211713]
Predicted Effect probably damaging
Transcript: ENSMUST00000002848
AA Change: P949Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002848
Gene: ENSMUSG00000002771
AA Change: P949Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
Pfam:ANF_receptor 89 330 1.7e-12 PFAM
PBPe 428 823 4.11e-65 SMART
Lig_chan-Glu_bd 471 527 7.88e-18 SMART
transmembrane domain 843 862 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 932 943 N/A INTRINSIC
low complexity region 969 1001 N/A INTRINSIC
low complexity region 1011 1039 N/A INTRINSIC
low complexity region 1065 1091 N/A INTRINSIC
low complexity region 1095 1120 N/A INTRINSIC
low complexity region 1192 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107723
SMART Domains Protein: ENSMUSP00000103351
Gene: ENSMUSG00000053801

DomainStartEndE-ValueType
Pfam:CAF1C_H4-bd 42 113 8.6e-18 PFAM
low complexity region 123 136 N/A INTRINSIC
Blast:WD40 138 179 1e-18 BLAST
WD40 203 243 1.58e-2 SMART
WD40 249 290 5.47e-6 SMART
WD40 297 336 2.22e-6 SMART
WD40 342 382 2.59e-7 SMART
Blast:WD40 404 442 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131384
SMART Domains Protein: ENSMUSP00000116252
Gene: ENSMUSG00000053801

DomainStartEndE-ValueType
Pfam:CAF1C_H4-bd 44 112 2.7e-15 PFAM
low complexity region 123 136 N/A INTRINSIC
Blast:WD40 138 179 1e-18 BLAST
WD40 203 243 1.58e-2 SMART
WD40 249 290 5.47e-6 SMART
WD40 297 336 2.22e-6 SMART
WD40 342 382 2.59e-7 SMART
Blast:WD40 404 442 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209301
Predicted Effect probably benign
Transcript: ENSMUST00000209484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210177
Predicted Effect probably benign
Transcript: ENSMUST00000211265
Predicted Effect probably damaging
Transcript: ENSMUST00000211713
AA Change: P949Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced spontaneous activity and an elevated auditory brainstem response threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dtl T C 1: 191,569,703 T81A probably damaging Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fam83g C A 11: 61,695,269 H228N probably damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Gcn1l1 T C 5: 115,616,478 V2379A probably benign Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rad52 T A 6: 119,912,985 probably benign Het
Rasa1 A G 13: 85,288,390 probably null Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Slc6a12 C T 6: 121,356,903 probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Thnsl1 C T 2: 21,213,364 T122I probably damaging Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Zscan10 A C 17: 23,607,234 E123D probably damaging Het
Other mutations in Grin2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Grin2d APN 7 45853292 missense probably damaging 0.99
IGL01772:Grin2d APN 7 45858466 missense probably benign 0.00
IGL01952:Grin2d APN 7 45862280 missense probably benign 0.23
IGL01994:Grin2d APN 7 45857972 missense probably damaging 1.00
IGL02161:Grin2d APN 7 45854422 missense possibly damaging 0.82
IGL03180:Grin2d APN 7 45853329 missense probably damaging 1.00
R1121:Grin2d UTSW 7 45854347 missense probably damaging 1.00
R1934:Grin2d UTSW 7 45856827 missense probably damaging 1.00
R2915:Grin2d UTSW 7 45833357 unclassified probably benign
R4162:Grin2d UTSW 7 45857618 missense probably damaging 0.98
R4781:Grin2d UTSW 7 45862481 missense probably damaging 1.00
R4785:Grin2d UTSW 7 45856781 missense probably damaging 0.96
R4820:Grin2d UTSW 7 45857939 missense probably damaging 1.00
R4877:Grin2d UTSW 7 45854615 missense probably damaging 1.00
R4979:Grin2d UTSW 7 45857933 missense probably benign 0.03
R5092:Grin2d UTSW 7 45854268 missense probably damaging 1.00
R6364:Grin2d UTSW 7 45858454 missense possibly damaging 0.54
R6565:Grin2d UTSW 7 45834755 missense probably damaging 1.00
R6747:Grin2d UTSW 7 45862268 missense probably damaging 0.99
R6816:Grin2d UTSW 7 45833682 unclassified probably benign
R7072:Grin2d UTSW 7 45857498 missense probably damaging 1.00
R7237:Grin2d UTSW 7 45866176 nonsense probably null
R7243:Grin2d UTSW 7 45866128 missense probably damaging 1.00
R7385:Grin2d UTSW 7 45857536 missense probably damaging 1.00
R7577:Grin2d UTSW 7 45862379 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTGTCAACCGACCAGTAG -3'
(R):5'- GGTATGTACAGCTGCTGCAG -3'

Sequencing Primer
(F):5'- TCTCGTCCTCGAAAGCCAG -3'
(R):5'- CTGCTGCAGCGCTGAGG -3'
Posted On2015-11-11