Incidental Mutation 'R4753:Fam83g'
ID357744
Institutional Source Beutler Lab
Gene Symbol Fam83g
Ensembl Gene ENSMUSG00000042377
Gene Namefamily with sequence similarity 83, member G
Synonyms
MMRRC Submission 041971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4753 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61684091-61709951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61695269 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 228 (H228N)
Ref Sequence ENSEMBL: ENSMUSP00000090697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051552] [ENSMUST00000093019] [ENSMUST00000148584] [ENSMUST00000151780]
Predicted Effect probably benign
Transcript: ENSMUST00000051552
SMART Domains Protein: ENSMUSP00000054407
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093019
AA Change: H228N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090697
Gene: ENSMUSG00000042377
AA Change: H228N

DomainStartEndE-ValueType
Pfam:DUF1669 15 309 1.8e-120 PFAM
Pfam:PLDc_2 165 304 5.5e-11 PFAM
low complexity region 316 336 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
low complexity region 721 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128196
Predicted Effect probably benign
Transcript: ENSMUST00000148584
SMART Domains Protein: ENSMUSP00000114523
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151780
SMART Domains Protein: ENSMUSP00000118196
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 48 185 3.5e-44 PFAM
Pfam:SSF 182 450 5e-79 PFAM
transmembrane domain 484 506 N/A INTRINSIC
transmembrane domain 547 566 N/A INTRINSIC
Meta Mutation Damage Score 0.6160 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mutations at this locus result in curly hair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dtl T C 1: 191,569,703 T81A probably damaging Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Gcn1l1 T C 5: 115,616,478 V2379A probably benign Het
Grin2d G T 7: 45,833,906 P949Q probably damaging Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rad52 T A 6: 119,912,985 probably benign Het
Rasa1 A G 13: 85,288,390 probably null Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Slc6a12 C T 6: 121,356,903 probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Thnsl1 C T 2: 21,213,364 T122I probably damaging Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Zscan10 A C 17: 23,607,234 E123D probably damaging Het
Other mutations in Fam83g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Fam83g APN 11 61684783 missense probably benign 0.00
IGL02958:Fam83g APN 11 61707722 missense probably damaging 1.00
PIT4402001:Fam83g UTSW 11 61703596 missense probably damaging 0.99
R0365:Fam83g UTSW 11 61703109 nonsense probably null
R0410:Fam83g UTSW 11 61703392 missense probably damaging 1.00
R0555:Fam83g UTSW 11 61707663 missense probably benign 0.37
R1163:Fam83g UTSW 11 61703436 missense probably damaging 1.00
R1413:Fam83g UTSW 11 61702678 missense probably damaging 1.00
R1474:Fam83g UTSW 11 61702993 missense probably damaging 1.00
R1916:Fam83g UTSW 11 61695168 missense probably damaging 1.00
R2006:Fam83g UTSW 11 61702975 missense possibly damaging 0.94
R2105:Fam83g UTSW 11 61703458 missense probably benign 0.01
R2134:Fam83g UTSW 11 61703684 missense probably benign 0.00
R2968:Fam83g UTSW 11 61703478 missense probably damaging 0.97
R4274:Fam83g UTSW 11 61701728 missense probably damaging 1.00
R5888:Fam83g UTSW 11 61702594 missense probably benign 0.38
R6280:Fam83g UTSW 11 61703182 missense probably benign 0.00
R7234:Fam83g UTSW 11 61702516 missense possibly damaging 0.75
R7257:Fam83g UTSW 11 61684753 missense probably damaging 1.00
R7588:Fam83g UTSW 11 61684696 missense probably damaging 1.00
R7761:Fam83g UTSW 11 61684758 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATTGCTGTGCTGGTAAACCAC -3'
(R):5'- TATCTTATCTGCCGGTTGAAGG -3'

Sequencing Primer
(F):5'- GGTAAACCACCCAGTCTTTTCCTG -3'
(R):5'- CTGCCGGTTGAAGGTAGTAAATATC -3'
Posted On2015-11-11