Incidental Mutation 'R0306:Dytn'
ID35775
Institutional Source Beutler Lab
Gene Symbol Dytn
Ensembl Gene ENSMUSG00000069085
Gene Namedystrotelin
SynonymsLOC241073
MMRRC Submission 038517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0306 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63622851-63686927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63685113 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 3 (P3S)
Ref Sequence ENSEMBL: ENSMUSP00000087787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090313
AA Change: P3S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087787
Gene: ENSMUSG00000069085
AA Change: P3S

DomainStartEndE-ValueType
Pfam:EF-hand_2 5 118 8.2e-14 PFAM
Pfam:EF-hand_3 123 217 7.2e-20 PFAM
ZnF_ZZ 222 267 7.34e-13 SMART
coiled coil region 382 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126954
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (61/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,179,889 V270A probably damaging Het
BC028528 C T 3: 95,889,820 probably benign Het
Bspry T C 4: 62,496,157 F329S probably damaging Het
Cd209a A G 8: 3,745,535 Y120H probably benign Het
Ces1f T C 8: 93,276,544 probably benign Het
Cfap52 T C 11: 67,954,070 N58D probably benign Het
Cfap74 G A 4: 155,465,439 probably benign Het
Chst8 T C 7: 34,675,298 E372G probably benign Het
Ddx49 A G 8: 70,294,672 probably benign Het
Ddx52 G T 11: 83,944,648 L133F probably benign Het
Defb26 T A 2: 152,507,968 I131F unknown Het
Dip2c T A 13: 9,604,599 S719T probably benign Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Doxl2 T C 6: 48,976,086 V315A probably damaging Het
Fmn2 T C 1: 174,609,484 probably benign Het
Gal3st1 T A 11: 3,998,546 L251Q probably damaging Het
Gm19684 A T 17: 36,127,408 probably benign Het
Il15 T A 8: 82,334,454 probably benign Het
Jag1 C T 2: 137,085,935 G852D probably damaging Het
Kbtbd4 A G 2: 90,914,186 probably benign Het
Kdm3b C A 18: 34,804,017 Q451K probably benign Het
Lrfn2 A T 17: 49,096,255 I469F probably damaging Het
Mep1a A T 17: 43,502,643 probably benign Het
Morn5 T C 2: 36,054,974 F70S probably damaging Het
Nav2 C A 7: 49,545,903 P1009Q probably benign Het
Noc3l T C 19: 38,807,650 Y334C probably damaging Het
Nsun4 A T 4: 116,052,822 Y180* probably null Het
Nup210l T C 3: 90,207,368 I1750T probably benign Het
Olfr1044 T A 2: 86,171,716 I34F possibly damaging Het
Olfr473 A T 7: 107,933,700 Y60F probably damaging Het
Olfr571 A T 7: 102,909,803 I12N probably benign Het
Parp14 A G 16: 35,856,574 L1008P probably benign Het
Paxbp1 A G 16: 91,022,115 V759A possibly damaging Het
Prdm10 C A 9: 31,316,224 Q42K probably damaging Het
Prkcsh T C 9: 22,006,526 probably benign Het
Psmg1 A G 16: 95,987,340 C138R probably damaging Het
Ptprb T C 10: 116,343,988 M1437T probably benign Het
Ryr3 A G 2: 112,775,655 probably null Het
Serpinf1 T C 11: 75,413,935 Y200C probably damaging Het
Shox2 T C 3: 66,973,834 H130R probably damaging Het
Slc22a1 A G 17: 12,662,598 F335L probably benign Het
Slc44a5 A G 3: 154,270,001 N683S probably damaging Het
Slc9a9 A T 9: 95,137,934 T519S probably benign Het
Smarca2 T A 19: 26,640,613 L348Q probably damaging Het
Sorbs1 T C 19: 40,344,411 D521G possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Srp19 T C 18: 34,334,576 probably benign Het
Stk35 T A 2: 129,801,763 Y222* probably null Het
Syt10 T G 15: 89,826,988 K114T probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Trpc4ap A G 2: 155,636,260 V662A probably benign Het
Ttll4 G A 1: 74,696,757 R1066Q probably benign Het
Tulp2 C T 7: 45,518,576 probably benign Het
Unc5b C A 10: 60,779,658 probably benign Het
Vmn1r230 T A 17: 20,846,633 I28K possibly damaging Het
Vmn2r118 A C 17: 55,608,616 F445V possibly damaging Het
Zfp142 C T 1: 74,570,182 E1485K probably damaging Het
Zfp819 C A 7: 43,617,197 A292E possibly damaging Het
Other mutations in Dytn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dytn APN 1 63678840 missense probably benign 0.34
IGL00870:Dytn APN 1 63677113 splice site probably benign
IGL02110:Dytn APN 1 63647473 missense possibly damaging 0.86
IGL02124:Dytn APN 1 63641092 missense probably damaging 1.00
IGL02211:Dytn APN 1 63674930 missense possibly damaging 0.61
IGL02712:Dytn APN 1 63664422 missense probably benign 0.00
IGL02832:Dytn APN 1 63643373 missense probably benign 0.45
IGL03036:Dytn APN 1 63641122 missense probably damaging 0.97
H8562:Dytn UTSW 1 63674912 missense possibly damaging 0.88
R0441:Dytn UTSW 1 63678774 splice site probably benign
R1453:Dytn UTSW 1 63633873 missense probably damaging 0.99
R1655:Dytn UTSW 1 63661198 missense probably damaging 1.00
R1892:Dytn UTSW 1 63677261 missense probably benign 0.04
R3030:Dytn UTSW 1 63633519 missense probably benign 0.04
R4062:Dytn UTSW 1 63647447 missense probably benign 0.05
R4640:Dytn UTSW 1 63643348 missense possibly damaging 0.52
R4804:Dytn UTSW 1 63643366 missense probably benign 0.08
R4931:Dytn UTSW 1 63633678 missense probably benign 0.26
R5015:Dytn UTSW 1 63633695 missense probably benign 0.00
R5054:Dytn UTSW 1 63661159 missense possibly damaging 0.64
R5120:Dytn UTSW 1 63623043 missense probably benign
R5888:Dytn UTSW 1 63677237 missense possibly damaging 0.91
R6243:Dytn UTSW 1 63647521 missense possibly damaging 0.76
R6400:Dytn UTSW 1 63641176 nonsense probably null
R7595:Dytn UTSW 1 63659002 missense probably damaging 0.99
R7705:Dytn UTSW 1 63678789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTCCTCCACGGCTTACTG -3'
(R):5'- GCTGCCCCGTAGGTGAATGATTCC -3'

Sequencing Primer
(F):5'- TACCAAATACCTGCTTAGTGACAG -3'
(R):5'- AGGTGAATGATTCCTCGGC -3'
Posted On2013-05-09