Incidental Mutation 'R4753:Rasa1'
ID 357750
Institutional Source Beutler Lab
Gene Symbol Rasa1
Ensembl Gene ENSMUSG00000021549
Gene Name RAS p21 protein activator 1
Synonyms p120-rasGAP, Gap
MMRRC Submission 041971-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4753 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 85214780-85289130 bp(-) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to G at 85288390 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109552]
AlphaFold E9PYG6
Predicted Effect probably null
Transcript: ENSMUST00000109552
SMART Domains Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 37 106 N/A INTRINSIC
low complexity region 119 142 N/A INTRINSIC
SH2 170 253 9.44e-29 SMART
SH3 273 331 1.7e-10 SMART
SH2 340 423 7.44e-27 SMART
PH 466 570 5.11e-20 SMART
C2 586 680 6.9e-10 SMART
RasGAP 689 1035 2.77e-156 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223598
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dtl T C 1: 191,569,703 T81A probably damaging Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fam83g C A 11: 61,695,269 H228N probably damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Gcn1l1 T C 5: 115,616,478 V2379A probably benign Het
Grin2d G T 7: 45,833,906 P949Q probably damaging Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rad52 T A 6: 119,912,985 probably benign Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Slc6a12 C T 6: 121,356,903 probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Thnsl1 C T 2: 21,213,364 T122I probably damaging Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Zscan10 A C 17: 23,607,234 E123D probably damaging Het
Other mutations in Rasa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Rasa1 APN 13 85288429 missense probably benign 0.02
IGL01396:Rasa1 APN 13 85258442 missense probably benign 0.10
IGL01670:Rasa1 APN 13 85225490 missense probably damaging 0.97
IGL02095:Rasa1 APN 13 85216155 missense probably benign 0.10
IGL02822:Rasa1 APN 13 85252514 missense probably damaging 0.97
IGL03126:Rasa1 APN 13 85256396 missense possibly damaging 0.94
F5770:Rasa1 UTSW 13 85226945 splice site probably null
PIT4458001:Rasa1 UTSW 13 85227118 missense possibly damaging 0.91
R1393:Rasa1 UTSW 13 85223522 missense probably damaging 1.00
R1441:Rasa1 UTSW 13 85252421 splice site probably null
R1907:Rasa1 UTSW 13 85226572 nonsense probably null
R4243:Rasa1 UTSW 13 85244195 missense probably damaging 1.00
R4593:Rasa1 UTSW 13 85238221 splice site probably null
R4687:Rasa1 UTSW 13 85226635 missense possibly damaging 0.89
R4689:Rasa1 UTSW 13 85238163 nonsense probably null
R4758:Rasa1 UTSW 13 85234448 missense probably benign
R4774:Rasa1 UTSW 13 85250502 intron probably benign
R5363:Rasa1 UTSW 13 85288555 missense possibly damaging 0.86
R5375:Rasa1 UTSW 13 85288903 intron probably benign
R6134:Rasa1 UTSW 13 85226626 missense probably benign 0.01
R6190:Rasa1 UTSW 13 85233695 missense probably benign 0.02
R6755:Rasa1 UTSW 13 85226598 missense possibly damaging 0.49
R7564:Rasa1 UTSW 13 85228708 missense probably benign 0.09
R7862:Rasa1 UTSW 13 85255411 missense probably damaging 0.99
R9138:Rasa1 UTSW 13 85221516 missense possibly damaging 0.93
R9280:Rasa1 UTSW 13 85288613 missense unknown
R9328:Rasa1 UTSW 13 85255456 critical splice acceptor site probably null
R9340:Rasa1 UTSW 13 85221530 missense probably damaging 0.98
RF016:Rasa1 UTSW 13 85223488 missense possibly damaging 0.65
X0023:Rasa1 UTSW 13 85233734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTACGTCTTCCCAAAAGAGC -3'
(R):5'- TGTCTTTGCCTGCTGAGACG -3'

Sequencing Primer
(F):5'- TAAACATACGAAGACGCCAGG -3'
(R):5'- CTGCTGAGACGCTCGGG -3'
Posted On 2015-11-11