Mutagenetix > Incidental Mutations

Incidental Mutation 'R4753:Rasa1'

357750

Institutional Source

Beutler Lab

Gene Symbol

Rasa1

Ensembl Gene

ENSMUSG00000021549

Gene Name

RAS p21 protein activator 1

Synonyms

p120-rasGAP, Gap

MMRRC Submission

041971-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4753 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85214780-85289130 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 85288390 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109552]

AlphaFold

E9PYG6

Predicted Effect

probably null
Transcript: ENSMUST00000109552

SMART Domains

Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549

Domain	Start	End	E-Value	Type
low complexity region	3	32	N/A	INTRINSIC
low complexity region	37	106	N/A	INTRINSIC
low complexity region	119	142	N/A	INTRINSIC
SH2	170	253	9.44e-29	SMART
SH3	273	331	1.7e-10	SMART
SH2	340	423	7.44e-27	SMART
PH	466	570	5.11e-20	SMART
C2	586	680	6.9e-10	SMART
RasGAP	689	1035	2.77e-156	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223598

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.6%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd55	T	A	13: 112,363,475	D257E	probably benign	Het
Arhgef18	T	C	8: 3,444,938	V399A	probably damaging	Het
Atp8b5	C	T	4: 43,372,710	P1117S	probably damaging	Het
Cd48	A	G	1: 171,699,588	Q194R	probably damaging	Het
Cdk13	G	A	13: 17,763,248	R737C	probably damaging	Het
Clasrp	A	T	7: 19,594,940	I89N	probably damaging	Het
Clrn1	G	T	3: 58,884,897	N48K	probably damaging	Het
Cntrl	T	A	2: 35,153,439	V1313E	possibly damaging	Het
Cyld	T	A	8: 88,744,816		probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dtl	T	C	1: 191,569,703	T81A	probably damaging	Het
Dus1l	C	T	11: 120,792,075	E299K	probably benign	Het
E130114P18Rik	A	T	4: 97,574,892	D14E	possibly damaging	Het
Fam83g	C	A	11: 61,695,269	H228N	probably damaging	Het
Fhod3	A	T	18: 25,090,325	K909N	possibly damaging	Het
Fign	T	A	2: 63,979,019	I636L	probably benign	Het
Foxm1	A	G	6: 128,372,556	E346G	probably null	Het
Gcc2	T	C	10: 58,290,382	Y1271H	probably benign	Het
Gcn1l1	T	C	5: 115,616,478	V2379A	probably benign	Het
Grin2d	G	T	7: 45,833,906	P949Q	probably damaging	Het
Ighv1-43	C	A	12: 114,946,142	M53I	probably benign	Het
Itgad	A	G	7: 128,223,703	*97W	probably null	Het
Jade1	C	T	3: 41,596,671	R2*	probably null	Het
Lama3	G	T	18: 12,482,084	C1355F	probably damaging	Het
Map3k13	T	C	16: 21,892,002	S12P	probably benign	Het
Masp2	A	G	4: 148,612,151	T402A	probably benign	Het
Mill1	A	C	7: 18,262,547	K96T	probably benign	Het
Muc19	T	G	15: 91,877,761		noncoding transcript	Het
Muc5b	C	A	7: 141,856,853	T1321N	unknown	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1377	T	C	11: 50,985,151	V150A	probably benign	Het
Olfr395	T	A	11: 73,906,851	I214F	probably damaging	Het
Pdgfra	C	T	5: 75,181,524	P669S	probably damaging	Het
Procr	A	G	2: 155,753,464	N63D	probably damaging	Het
Prrc2c	A	G	1: 162,691,230	S2136P	probably damaging	Het
Rab11fip1	T	C	8: 27,152,741	M677V	probably benign	Het
Rad52	T	A	6: 119,912,985		probably benign	Het
Rogdi	T	C	16: 5,010,499	T189A	probably damaging	Het
Rph3al	G	A	11: 75,909,019	T38M	probably damaging	Het
Rps6ka2	T	A	17: 7,299,308	V655E	possibly damaging	Het
Sik3	T	C	9: 46,198,214	F499L	probably damaging	Het
Skint4	A	G	4: 112,146,531	N387S	probably benign	Het
Slc6a12	C	T	6: 121,356,903		probably benign	Het
Stk36	A	G	1: 74,626,096	T667A	probably benign	Het
Svep1	T	C	4: 58,053,212	I3378V	probably benign	Het
Thnsl1	C	T	2: 21,213,364	T122I	probably damaging	Het
Timeless	G	A	10: 128,240,020		probably benign	Het
Tnxb	G	A	17: 34,695,935	V1966I	possibly damaging	Het
Tril	A	G	6: 53,819,713	F175L	probably damaging	Het
Vav1	A	G	17: 57,306,140	Y604C	probably damaging	Het
Zfp423	T	A	8: 87,781,446	M736L	probably benign	Het
Zscan10	A	C	17: 23,607,234	E123D	probably damaging	Het

Other mutations in Rasa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Rasa1	APN	13	85288429	missense	probably benign	0.02
IGL01396:Rasa1	APN	13	85258442	missense	probably benign	0.10
IGL01670:Rasa1	APN	13	85225490	missense	probably damaging	0.97
IGL02095:Rasa1	APN	13	85216155	missense	probably benign	0.10
IGL02822:Rasa1	APN	13	85252514	missense	probably damaging	0.97
IGL03126:Rasa1	APN	13	85256396	missense	possibly damaging	0.94
F5770:Rasa1	UTSW	13	85226945	splice site	probably null
PIT4458001:Rasa1	UTSW	13	85227118	missense	possibly damaging	0.91
R1393:Rasa1	UTSW	13	85223522	missense	probably damaging	1.00
R1441:Rasa1	UTSW	13	85252421	splice site	probably null
R1907:Rasa1	UTSW	13	85226572	nonsense	probably null
R4243:Rasa1	UTSW	13	85244195	missense	probably damaging	1.00
R4593:Rasa1	UTSW	13	85238221	splice site	probably null
R4687:Rasa1	UTSW	13	85226635	missense	possibly damaging	0.89
R4689:Rasa1	UTSW	13	85238163	nonsense	probably null
R4758:Rasa1	UTSW	13	85234448	missense	probably benign
R4774:Rasa1	UTSW	13	85250502	intron	probably benign
R5363:Rasa1	UTSW	13	85288555	missense	possibly damaging	0.86
R5375:Rasa1	UTSW	13	85288903	intron	probably benign
R6134:Rasa1	UTSW	13	85226626	missense	probably benign	0.01
R6190:Rasa1	UTSW	13	85233695	missense	probably benign	0.02
R6755:Rasa1	UTSW	13	85226598	missense	possibly damaging	0.49
R7564:Rasa1	UTSW	13	85228708	missense	probably benign	0.09
R7862:Rasa1	UTSW	13	85255411	missense	probably damaging	0.99
R9138:Rasa1	UTSW	13	85221516	missense	possibly damaging	0.93
R9280:Rasa1	UTSW	13	85288613	missense	unknown
R9328:Rasa1	UTSW	13	85255456	critical splice acceptor site	probably null
R9340:Rasa1	UTSW	13	85221530	missense	probably damaging	0.98
RF016:Rasa1	UTSW	13	85223488	missense	possibly damaging	0.65
X0023:Rasa1	UTSW	13	85233734	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTACGTCTTCCCAAAAGAGC -3'
(R):5'- TGTCTTTGCCTGCTGAGACG -3'

Sequencing Primer
(F):5'- TAAACATACGAAGACGCCAGG -3'
(R):5'- CTGCTGAGACGCTCGGG -3'

Posted On

2015-11-11