Incidental Mutation 'R4753:Zscan10'
ID357756
Institutional Source Beutler Lab
Gene Symbol Zscan10
Ensembl Gene ENSMUSG00000023902
Gene Namezinc finger and SCAN domain containing 10
SynonymsZscan10, Zfp206
MMRRC Submission 041971-MU
Accession Numbers

Ncbi RefSeq: NM_001033425.3; MGI:3040700

Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R4753 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23600856-23611019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23607234 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 123 (E123D)
Ref Sequence ENSEMBL: ENSMUSP00000120876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095595] [ENSMUST00000115509] [ENSMUST00000117606] [ENSMUST00000118369] [ENSMUST00000120967] [ENSMUST00000122285] [ENSMUST00000123866] [ENSMUST00000129227] [ENSMUST00000138487] [ENSMUST00000148062]
Predicted Effect probably damaging
Transcript: ENSMUST00000095595
AA Change: E168D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093255
Gene: ENSMUSG00000023902
AA Change: E168D

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 343 366 4.4e-2 SMART
ZnF_C2H2 378 400 5.59e-4 SMART
ZnF_C2H2 406 428 1.25e-1 SMART
ZnF_C2H2 434 456 2.05e-2 SMART
ZnF_C2H2 478 500 2.75e-3 SMART
low complexity region 507 521 N/A INTRINSIC
ZnF_C2H2 524 547 1.82e-3 SMART
ZnF_C2H2 553 575 3.16e-3 SMART
ZnF_C2H2 581 603 1.95e-3 SMART
ZnF_C2H2 609 631 4.17e-3 SMART
ZnF_C2H2 637 659 1.56e-2 SMART
ZnF_C2H2 665 687 2.4e-3 SMART
ZnF_C2H2 693 715 1.98e-4 SMART
ZnF_C2H2 726 748 1.58e-3 SMART
ZnF_C2H2 754 776 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115509
SMART Domains Protein: ENSMUSP00000111171
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 233 256 4.4e-2 SMART
ZnF_C2H2 268 290 5.59e-4 SMART
ZnF_C2H2 296 318 1.25e-1 SMART
ZnF_C2H2 324 346 2.05e-2 SMART
ZnF_C2H2 368 390 2.75e-3 SMART
low complexity region 397 411 N/A INTRINSIC
ZnF_C2H2 414 437 1.82e-3 SMART
ZnF_C2H2 443 465 3.16e-3 SMART
ZnF_C2H2 471 493 1.95e-3 SMART
ZnF_C2H2 499 521 4.17e-3 SMART
ZnF_C2H2 527 549 1.56e-2 SMART
ZnF_C2H2 555 577 2.4e-3 SMART
ZnF_C2H2 583 605 1.98e-4 SMART
ZnF_C2H2 616 638 1.58e-3 SMART
ZnF_C2H2 644 666 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117606
SMART Domains Protein: ENSMUSP00000112460
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 147 1.73e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118369
SMART Domains Protein: ENSMUSP00000113757
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120967
AA Change: E168D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113386
Gene: ENSMUSG00000023902
AA Change: E168D

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 346 368 5.59e-4 SMART
ZnF_C2H2 374 396 1.25e-1 SMART
ZnF_C2H2 402 424 2.05e-2 SMART
ZnF_C2H2 446 468 2.75e-3 SMART
low complexity region 475 489 N/A INTRINSIC
ZnF_C2H2 492 515 1.82e-3 SMART
ZnF_C2H2 521 543 3.16e-3 SMART
ZnF_C2H2 549 571 1.95e-3 SMART
ZnF_C2H2 577 599 4.17e-3 SMART
ZnF_C2H2 605 627 1.56e-2 SMART
ZnF_C2H2 633 655 2.4e-3 SMART
ZnF_C2H2 661 683 1.98e-4 SMART
ZnF_C2H2 694 716 1.58e-3 SMART
ZnF_C2H2 722 744 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122285
SMART Domains Protein: ENSMUSP00000112559
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123866
SMART Domains Protein: ENSMUSP00000116748
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 2.38e-34 SMART
ZnF_C2H2 267 290 4.4e-2 SMART
ZnF_C2H2 302 324 5.59e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125912
Predicted Effect probably benign
Transcript: ENSMUST00000129227
SMART Domains Protein: ENSMUSP00000118987
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
ZnF_C2H2 142 164 5.59e-4 SMART
ZnF_C2H2 170 192 1.25e-1 SMART
ZnF_C2H2 198 220 2.05e-2 SMART
ZnF_C2H2 242 264 2.75e-3 SMART
low complexity region 271 285 N/A INTRINSIC
ZnF_C2H2 288 311 1.82e-3 SMART
ZnF_C2H2 317 339 3.16e-3 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 4.17e-3 SMART
ZnF_C2H2 401 423 1.56e-2 SMART
ZnF_C2H2 429 451 2.4e-3 SMART
ZnF_C2H2 457 479 1.98e-4 SMART
ZnF_C2H2 490 512 1.58e-3 SMART
ZnF_C2H2 518 540 6.42e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133749
Predicted Effect probably benign
Transcript: ENSMUST00000138487
SMART Domains Protein: ENSMUSP00000114341
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 236 258 5.59e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148062
AA Change: E123D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120876
Gene: ENSMUSG00000023902
AA Change: E123D

DomainStartEndE-ValueType
Pfam:SCAN 37 88 7.5e-20 PFAM
low complexity region 128 149 N/A INTRINSIC
ZnF_C2H2 301 323 5.59e-4 SMART
ZnF_C2H2 329 351 1.25e-1 SMART
ZnF_C2H2 357 379 2.05e-2 SMART
ZnF_C2H2 401 423 2.75e-3 SMART
low complexity region 430 444 N/A INTRINSIC
ZnF_C2H2 447 470 1.82e-3 SMART
ZnF_C2H2 476 498 3.16e-3 SMART
ZnF_C2H2 504 526 1.95e-3 SMART
ZnF_C2H2 532 554 4.17e-3 SMART
ZnF_C2H2 560 582 1.56e-2 SMART
ZnF_C2H2 588 610 2.4e-3 SMART
ZnF_C2H2 616 638 1.98e-4 SMART
ZnF_C2H2 649 671 1.58e-3 SMART
ZnF_C2H2 677 699 6.42e-4 SMART
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit a pleiotropic phenotype including reduced weight, mild hypoplasia in the spleen, heart and long bones, eye malformations including microphthalmia, altered platelet counts, an activated immune status, and behavioral alterations. [provided by MGI curators]
Allele List at MGI

All alleles(357) : Targeted(5) Gene trapped(352)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dtl T C 1: 191,569,703 T81A probably damaging Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fam83g C A 11: 61,695,269 H228N probably damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Gcn1l1 T C 5: 115,616,478 V2379A probably benign Het
Grin2d G T 7: 45,833,906 P949Q probably damaging Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rad52 T A 6: 119,912,985 probably benign Het
Rasa1 A G 13: 85,288,390 probably null Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Slc6a12 C T 6: 121,356,903 probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Thnsl1 C T 2: 21,213,364 T122I probably damaging Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Other mutations in Zscan10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zscan10 APN 17 23609461 missense probably damaging 0.98
IGL01353:Zscan10 APN 17 23609600 missense probably damaging 1.00
IGL02327:Zscan10 APN 17 23607572 splice site probably benign
IGL02556:Zscan10 APN 17 23608145 missense possibly damaging 0.90
FR4737:Zscan10 UTSW 17 23609445 small deletion probably benign
P0043:Zscan10 UTSW 17 23609620 nonsense probably null
R0345:Zscan10 UTSW 17 23610082 missense probably damaging 1.00
R0401:Zscan10 UTSW 17 23605915 missense probably damaging 1.00
R0699:Zscan10 UTSW 17 23608118 missense probably damaging 1.00
R0838:Zscan10 UTSW 17 23610034 missense possibly damaging 0.83
R0919:Zscan10 UTSW 17 23610007 missense probably damaging 0.99
R1940:Zscan10 UTSW 17 23609852 missense probably damaging 1.00
R4647:Zscan10 UTSW 17 23610340 missense probably benign
R4971:Zscan10 UTSW 17 23607173 missense possibly damaging 0.67
R5110:Zscan10 UTSW 17 23609632 missense probably damaging 1.00
R5410:Zscan10 UTSW 17 23610421 missense probably damaging 1.00
R5516:Zscan10 UTSW 17 23609359 missense possibly damaging 0.66
R5871:Zscan10 UTSW 17 23607267 intron probably benign
R6109:Zscan10 UTSW 17 23607129 missense probably damaging 0.98
R6626:Zscan10 UTSW 17 23605857 missense probably damaging 1.00
R6750:Zscan10 UTSW 17 23607190 missense possibly damaging 0.49
R6846:Zscan10 UTSW 17 23605607 missense probably damaging 0.97
R7184:Zscan10 UTSW 17 23607029 intron probably null
R7223:Zscan10 UTSW 17 23609482 missense probably benign 0.00
R7436:Zscan10 UTSW 17 23610005 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGGCAGACTCAGTAGATTATGGC -3'
(R):5'- GAAGTTACCCCAGCATTCTCCC -3'

Sequencing Primer
(F):5'- ACTCAGTAGATTATGGCATGTGTCC -3'
(R):5'- ACATACAGTCTGTCTCCCGGG -3'
Posted On2015-11-11