Mutagenetix > Incidental Mutations

Incidental Mutation 'R4754:Abcb4'

357785

Institutional Source

Beutler Lab

Gene Symbol

Abcb4

Ensembl Gene

ENSMUSG00000042476

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 4

Synonyms

Pgy-2, Mdr2, Pgy2, mdr-2

Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4754 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8893717-8959231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 8910717 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 266 (F266L)

Ref Sequence

ENSEMBL: ENSMUSP00000142425 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003717
AA Change: F266L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: F266L

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	342	2e-94	PFAM
AAA	418	610	3.97e-20	SMART
Pfam:ABC_membrane	708	982	6.3e-77	PFAM
AAA	1058	1246	4.49e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000196067
AA Change: F266L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: F266L

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	344	2.4e-95	PFAM
AAA	418	610	6.2e-22	SMART
Pfam:ABC_membrane	708	882	1.6e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199413

Meta Mutation Damage Score

0.4777

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (107/109)

MGI Phenotype

Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	A	T	9: 105,144,393	F151L	probably benign	Het
4932438A13Rik	C	T	3: 37,022,466	Q3663*	probably null	Het
A130010J15Rik	A	G	1: 193,174,529	Y63C	probably damaging	Het
Adam8	A	T	7: 139,984,780	I681N	possibly damaging	Het
Adgrf3	T	A	5: 30,197,617		probably null	Het
Ang2	A	G	14: 51,195,517	V136A	probably damaging	Het
Ankar	C	T	1: 72,698,694	G110R	probably damaging	Het
Ap3b1	T	C	13: 94,403,960	L130P	probably damaging	Het
Apc2	T	G	10: 80,314,358	W1749G	probably benign	Het
Asb2	T	C	12: 103,323,837	N565S	possibly damaging	Het
B3gnt7	C	A	1: 86,305,557	T58K	probably benign	Het
Brpf1	T	A	6: 113,320,447	N876K	possibly damaging	Het
Ccdc157	T	C	11: 4,148,994	I69V	possibly damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdh20	A	T	1: 104,984,685	I555F	probably damaging	Het
Cfap73	T	C	5: 120,629,664	D274G	probably damaging	Het
Chd5	T	A	4: 152,377,746	I1310N	probably damaging	Het
Ckap2	T	A	8: 22,168,895	I611F	possibly damaging	Het
Cpeb2	A	G	5: 43,285,857	I964V	possibly damaging	Het
Ctbp2	C	A	7: 133,023,558		probably null	Het
Dhrs2	A	T	14: 55,238,748	I142F	probably damaging	Het
Dnah5	T	A	15: 28,420,955		probably null	Het
Dst	T	C	1: 34,212,309	S1822P	probably damaging	Het
Ect2	T	C	3: 27,126,963	K581E	probably damaging	Het
Edem1	C	T	6: 108,841,697	T222M	probably damaging	Het
Eif2ak1	A	G	5: 143,901,803	M592V	probably damaging	Het
Endou	T	G	15: 97,726,539	D49A	probably damaging	Het
Ensa	A	G	3: 95,622,554		probably benign	Het
Evc2	G	T	5: 37,387,031	R708L	probably damaging	Het
Fam120b	T	A	17: 15,422,962	C668S	probably damaging	Het
Fam135a	A	T	1: 24,028,754	C798*	probably null	Het
Fam135b	T	C	15: 71,462,951	D798G	probably benign	Het
Fam208a	A	T	14: 27,461,095	I504L	probably benign	Het
Fshb	A	C	2: 107,057,282	*131E	probably null	Het
G3bp2	C	T	5: 92,054,909	V441M	possibly damaging	Het
Galnt6	A	T	15: 100,699,224	F354I	probably damaging	Het
Gm1123	C	A	9: 99,023,240		probably null	Het
Gm1123	A	T	9: 99,023,241		probably null	Het
Gm15130	T	C	2: 111,142,862	N115S	unknown	Het
Gm7104	A	G	12: 88,285,995		noncoding transcript	Het
Gm9762	A	T	3: 78,966,421		noncoding transcript	Het
Grip2	A	G	6: 91,779,182	V508A	probably damaging	Het
Grip2	T	C	6: 91,779,192	T505A	probably damaging	Het
Haus4	A	G	14: 54,549,892		probably null	Het
Herc1	T	A	9: 66,501,206	D4571E	probably benign	Het
Hnrnpk	T	A	13: 58,399,136		probably benign	Het
Ica1l	T	C	1: 60,028,162	Y23C	probably damaging	Het
Kansl2-ps	A	G	7: 72,673,133		noncoding transcript	Het
Kcnma1	T	C	14: 23,363,836	D833G	probably damaging	Het
Kmt2e	A	T	5: 23,482,441	I430F	possibly damaging	Het
Lama2	C	A	10: 27,118,531	R1794L	possibly damaging	Het
Mcpt1	T	A	14: 56,018,680	F59I	probably damaging	Het
Mib2	G	T	4: 155,655,365	T783K	possibly damaging	Het
Nlrp4g	T	C	9: 124,349,788		noncoding transcript	Het
Obscn	T	C	11: 59,036,043	I6352V	possibly damaging	Het
Olfr1245	A	T	2: 89,575,047	H226Q	probably benign	Het
Olfr1456-ps1	T	A	19: 13,078,861		noncoding transcript	Het
Olfr531	C	T	7: 140,400,159	A296T	probably damaging	Het
Olfr68	T	C	7: 103,777,668	I226V	probably benign	Het
Olfr728	T	A	14: 50,140,033	N202I	possibly damaging	Het
Olfr728	T	G	14: 50,140,034	N202H	probably benign	Het
Pcdh10	G	A	3: 45,380,637	R462H	probably damaging	Het
Pcdhga12	C	A	18: 37,766,551	N145K	probably damaging	Het
Pik3r6	T	A	11: 68,544,775	L613Q	probably damaging	Het
Pknox2	T	C	9: 36,909,720	D282G	probably damaging	Het
Plod2	T	G	9: 92,606,531	Y624*	probably null	Het
Prkd3	C	A	17: 78,956,614	V684F	probably damaging	Het
Ptpn1	T	A	2: 167,974,160	V198D	probably damaging	Het
Ptpn12	G	T	5: 20,998,589	P397Q	probably benign	Het
Rad1	C	A	15: 10,493,126		probably benign	Het
Rasl11a	A	G	5: 146,847,015	D90G	probably benign	Het
Rnf181	A	G	6: 72,360,560		probably benign	Het
Ryr3	T	C	2: 112,757,639	I2652M	possibly damaging	Het
Siglecg	C	T	7: 43,411,871		probably benign	Het
Slc22a3	T	C	17: 12,507,195	S44G	probably benign	Het
Slc38a1	A	T	15: 96,576,782	F463I	probably damaging	Het
Smg1	A	T	7: 118,156,731		probably benign	Het
Syk	T	C	13: 52,612,259		probably benign	Het
Tbc1d5	T	C	17: 50,800,165	I454M	probably benign	Het
Tmed6	C	A	8: 107,063,730	D146Y	probably damaging	Het
Tmem132e	A	T	11: 82,444,851	K828*	probably null	Het
Tmprss15	A	T	16: 79,054,124	S294T	probably damaging	Het
Trp53bp1	A	G	2: 121,207,879	S1493P	probably damaging	Het
Tshb	A	T	3: 102,778,175	I46N	probably damaging	Het
Tspan11	T	C	6: 127,938,220	V99A	probably benign	Het
Ttn	T	C	2: 76,715,561	T24176A	probably benign	Het
Vmn1r8	T	C	6: 57,035,967	M1T	probably null	Het
Vmn2r104	A	T	17: 20,040,768	Y464*	probably null	Het
Vmn2r110	T	C	17: 20,596,196	T22A	probably benign	Het
Vmn2r17	T	A	5: 109,452,849	I671K	probably damaging	Het
Zbtb21	T	C	16: 97,951,266	N606D	probably damaging	Het
Zfy2	A	T	Y: 2,121,477	S139T	probably benign	Het
Zkscan17	G	A	11: 59,503,025	R156*	probably null	Het
Zp2	A	G	7: 120,138,318	V248A	probably benign	Het

Other mutations in Abcb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Abcb4	APN	5	8950073	missense	probably benign	0.02
IGL00663:Abcb4	APN	5	8927916	missense	probably damaging	1.00
IGL00671:Abcb4	APN	5	8930745	nonsense	probably null
IGL00822:Abcb4	APN	5	8950046	missense	probably benign
IGL01080:Abcb4	APN	5	8934258	missense	probably damaging	1.00
IGL01152:Abcb4	APN	5	8950678	missense	probably benign	0.19
IGL01329:Abcb4	APN	5	8894166	critical splice donor site	probably null
IGL01483:Abcb4	APN	5	8927871	missense	probably damaging	0.99
IGL01594:Abcb4	APN	5	8946071	splice site	probably null
IGL01785:Abcb4	APN	5	8915058	nonsense	probably null
IGL01968:Abcb4	APN	5	8927913	missense	probably benign	0.33
IGL02579:Abcb4	APN	5	8955537	missense	probably damaging	1.00
IGL02654:Abcb4	APN	5	8927826	missense	possibly damaging	0.80
IGL02658:Abcb4	APN	5	8934240	missense	probably benign
IGL03229:Abcb4	APN	5	8940936	missense	probably damaging	0.97
IGL03335:Abcb4	APN	5	8935258	missense	probably benign	0.00
FR4737:Abcb4	UTSW	5	8896597	small deletion	probably benign
P0014:Abcb4	UTSW	5	8950083	missense	probably benign	0.01
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0309:Abcb4	UTSW	5	8939835	missense	probably damaging	1.00
R0311:Abcb4	UTSW	5	8934243	missense	probably benign
R0420:Abcb4	UTSW	5	8941050	missense	probably benign	0.03
R0449:Abcb4	UTSW	5	8939885	nonsense	probably null
R0609:Abcb4	UTSW	5	8947376	missense	probably damaging	0.96
R1459:Abcb4	UTSW	5	8918662	missense	possibly damaging	0.61
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1812:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R1944:Abcb4	UTSW	5	8930796	missense	probably damaging	1.00
R2002:Abcb4	UTSW	5	8905989	missense	probably benign	0.01
R2256:Abcb4	UTSW	5	8958431	missense	probably damaging	1.00
R3116:Abcb4	UTSW	5	8896610	missense	possibly damaging	0.86
R4112:Abcb4	UTSW	5	8936783	critical splice acceptor site	probably null
R4354:Abcb4	UTSW	5	8918771	missense	probably benign	0.44
R4512:Abcb4	UTSW	5	8928573	missense	probably damaging	1.00
R4588:Abcb4	UTSW	5	8947328	missense	probably benign	0.01
R4628:Abcb4	UTSW	5	8907399	missense	probably benign	0.08
R4708:Abcb4	UTSW	5	8915125	missense	possibly damaging	0.90
R4714:Abcb4	UTSW	5	8930906	splice site	probably null
R4846:Abcb4	UTSW	5	8935180	missense	probably benign
R4896:Abcb4	UTSW	5	8907267	missense	possibly damaging	0.81
R4944:Abcb4	UTSW	5	8934327	critical splice donor site	probably null
R4994:Abcb4	UTSW	5	8928524	missense	probably damaging	1.00
R5022:Abcb4	UTSW	5	8909054	splice site	probably null
R5537:Abcb4	UTSW	5	8955485	missense	probably damaging	0.98
R5754:Abcb4	UTSW	5	8934320	missense	probably benign
R5833:Abcb4	UTSW	5	8958314	missense	probably damaging	1.00
R5934:Abcb4	UTSW	5	8930806	missense	probably benign	0.18
R6006:Abcb4	UTSW	5	8946026	missense	probably damaging	0.99
R6146:Abcb4	UTSW	5	8896587	missense	probably benign	0.05
R6183:Abcb4	UTSW	5	8918718	missense	probably benign
R6260:Abcb4	UTSW	5	8934219	nonsense	probably null
R6561:Abcb4	UTSW	5	8927825	missense	probably benign	0.14
R7016:Abcb4	UTSW	5	8936843	missense	probably benign	0.35
R7081:Abcb4	UTSW	5	8934263	missense	probably benign
R7326:Abcb4	UTSW	5	8934226	missense	probably benign	0.00
R7375:Abcb4	UTSW	5	8918671	missense	probably benign
R7787:Abcb4	UTSW	5	8909220	missense	probably damaging	1.00
R7836:Abcb4	UTSW	5	8934203	missense	probably benign
R8128:Abcb4	UTSW	5	8958395	missense	probably damaging	1.00
R8350:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R8438:Abcb4	UTSW	5	8946120	critical splice donor site	probably null
R8447:Abcb4	UTSW	5	8907278	missense	probably damaging	0.97
RF015:Abcb4	UTSW	5	8896594	frame shift	probably null
RF047:Abcb4	UTSW	5	8896595	frame shift	probably null
Z1176:Abcb4	UTSW	5	8959005	missense	probably damaging	1.00
Z1177:Abcb4	UTSW	5	8939906	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGCATTAAAGCTCTGTGCAG -3'
(R):5'- TTTGTCGAACACGTAAGGTTG -3'

Sequencing Primer
(F):5'- TAAAGCTCTGTGCAGACTGC -3'
(R):5'- TTTGTCGAACACGTAAGGTTGAGAAC -3'

Posted On

2015-11-11