Incidental Mutation 'R4754:Kmt2e'
ID357787
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4754 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23482441 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 430 (I430F)
Ref Sequence ENSEMBL: ENSMUSP00000110781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000146375] [ENSMUST00000196260] [ENSMUST00000196889]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094962
AA Change: I430F

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: I430F

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000115128
AA Change: I430F

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: I430F

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000146375
SMART Domains Protein: ENSMUSP00000142547
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157545
Predicted Effect probably benign
Transcript: ENSMUST00000196260
SMART Domains Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196889
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200330
Meta Mutation Damage Score 0.4371 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,393 F151L probably benign Het
4932438A13Rik C T 3: 37,022,466 Q3663* probably null Het
A130010J15Rik A G 1: 193,174,529 Y63C probably damaging Het
Abcb4 C A 5: 8,910,717 F266L probably damaging Het
Adam8 A T 7: 139,984,780 I681N possibly damaging Het
Adgrf3 T A 5: 30,197,617 probably null Het
Ang2 A G 14: 51,195,517 V136A probably damaging Het
Ankar C T 1: 72,698,694 G110R probably damaging Het
Ap3b1 T C 13: 94,403,960 L130P probably damaging Het
Apc2 T G 10: 80,314,358 W1749G probably benign Het
Asb2 T C 12: 103,323,837 N565S possibly damaging Het
B3gnt7 C A 1: 86,305,557 T58K probably benign Het
Brpf1 T A 6: 113,320,447 N876K possibly damaging Het
Ccdc157 T C 11: 4,148,994 I69V possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh20 A T 1: 104,984,685 I555F probably damaging Het
Cfap73 T C 5: 120,629,664 D274G probably damaging Het
Chd5 T A 4: 152,377,746 I1310N probably damaging Het
Ckap2 T A 8: 22,168,895 I611F possibly damaging Het
Cpeb2 A G 5: 43,285,857 I964V possibly damaging Het
Ctbp2 C A 7: 133,023,558 probably null Het
Dhrs2 A T 14: 55,238,748 I142F probably damaging Het
Dnah5 T A 15: 28,420,955 probably null Het
Dst T C 1: 34,212,309 S1822P probably damaging Het
Ect2 T C 3: 27,126,963 K581E probably damaging Het
Edem1 C T 6: 108,841,697 T222M probably damaging Het
Eif2ak1 A G 5: 143,901,803 M592V probably damaging Het
Endou T G 15: 97,726,539 D49A probably damaging Het
Ensa A G 3: 95,622,554 probably benign Het
Evc2 G T 5: 37,387,031 R708L probably damaging Het
Fam120b T A 17: 15,422,962 C668S probably damaging Het
Fam135a A T 1: 24,028,754 C798* probably null Het
Fam135b T C 15: 71,462,951 D798G probably benign Het
Fam208a A T 14: 27,461,095 I504L probably benign Het
Fshb A C 2: 107,057,282 *131E probably null Het
G3bp2 C T 5: 92,054,909 V441M possibly damaging Het
Galnt6 A T 15: 100,699,224 F354I probably damaging Het
Gm1123 C A 9: 99,023,240 probably null Het
Gm1123 A T 9: 99,023,241 probably null Het
Gm15130 T C 2: 111,142,862 N115S unknown Het
Gm7104 A G 12: 88,285,995 noncoding transcript Het
Gm9762 A T 3: 78,966,421 noncoding transcript Het
Grip2 A G 6: 91,779,182 V508A probably damaging Het
Grip2 T C 6: 91,779,192 T505A probably damaging Het
Haus4 A G 14: 54,549,892 probably null Het
Herc1 T A 9: 66,501,206 D4571E probably benign Het
Hnrnpk T A 13: 58,399,136 probably benign Het
Ica1l T C 1: 60,028,162 Y23C probably damaging Het
Kansl2-ps A G 7: 72,673,133 noncoding transcript Het
Kcnma1 T C 14: 23,363,836 D833G probably damaging Het
Lama2 C A 10: 27,118,531 R1794L possibly damaging Het
Mcpt1 T A 14: 56,018,680 F59I probably damaging Het
Mib2 G T 4: 155,655,365 T783K possibly damaging Het
Nlrp4g T C 9: 124,349,788 noncoding transcript Het
Obscn T C 11: 59,036,043 I6352V possibly damaging Het
Olfr1245 A T 2: 89,575,047 H226Q probably benign Het
Olfr1456-ps1 T A 19: 13,078,861 noncoding transcript Het
Olfr531 C T 7: 140,400,159 A296T probably damaging Het
Olfr68 T C 7: 103,777,668 I226V probably benign Het
Olfr728 T A 14: 50,140,033 N202I possibly damaging Het
Olfr728 T G 14: 50,140,034 N202H probably benign Het
Pcdh10 G A 3: 45,380,637 R462H probably damaging Het
Pcdhga12 C A 18: 37,766,551 N145K probably damaging Het
Pik3r6 T A 11: 68,544,775 L613Q probably damaging Het
Pknox2 T C 9: 36,909,720 D282G probably damaging Het
Plod2 T G 9: 92,606,531 Y624* probably null Het
Prkd3 C A 17: 78,956,614 V684F probably damaging Het
Ptpn1 T A 2: 167,974,160 V198D probably damaging Het
Ptpn12 G T 5: 20,998,589 P397Q probably benign Het
Rad1 C A 15: 10,493,126 probably benign Het
Rasl11a A G 5: 146,847,015 D90G probably benign Het
Rnf181 A G 6: 72,360,560 probably benign Het
Ryr3 T C 2: 112,757,639 I2652M possibly damaging Het
Siglecg C T 7: 43,411,871 probably benign Het
Slc22a3 T C 17: 12,507,195 S44G probably benign Het
Slc38a1 A T 15: 96,576,782 F463I probably damaging Het
Smg1 A T 7: 118,156,731 probably benign Het
Syk T C 13: 52,612,259 probably benign Het
Tbc1d5 T C 17: 50,800,165 I454M probably benign Het
Tmed6 C A 8: 107,063,730 D146Y probably damaging Het
Tmem132e A T 11: 82,444,851 K828* probably null Het
Tmprss15 A T 16: 79,054,124 S294T probably damaging Het
Trp53bp1 A G 2: 121,207,879 S1493P probably damaging Het
Tshb A T 3: 102,778,175 I46N probably damaging Het
Tspan11 T C 6: 127,938,220 V99A probably benign Het
Ttn T C 2: 76,715,561 T24176A probably benign Het
Vmn1r8 T C 6: 57,035,967 M1T probably null Het
Vmn2r104 A T 17: 20,040,768 Y464* probably null Het
Vmn2r110 T C 17: 20,596,196 T22A probably benign Het
Vmn2r17 T A 5: 109,452,849 I671K probably damaging Het
Zbtb21 T C 16: 97,951,266 N606D probably damaging Het
Zfy2 A T Y: 2,121,477 S139T probably benign Het
Zkscan17 G A 11: 59,503,025 R156* probably null Het
Zp2 A G 7: 120,138,318 V248A probably benign Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
R8137:Kmt2e UTSW 5 23501954 missense probably damaging 1.00
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAATGGGACTTTTCCATGACATG -3'
(R):5'- GGGTGAAAACCTTGTAACAGC -3'

Sequencing Primer
(F):5'- TCTATAAGTTCTAGGCCAGCCAGG -3'
(R):5'- CACTTAACCCAGAGACTTTTACTG -3'
Posted On2015-11-11