Incidental Mutation 'R4754:Adam8'
ID357814
Institutional Source Beutler Lab
Gene Symbol Adam8
Ensembl Gene ENSMUSG00000025473
Gene Namea disintegrin and metallopeptidase domain 8
SynonymsCD156, MS2, E430039A18Rik, CD156a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4754 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139978932-139992562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139984780 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 681 (I681N)
Ref Sequence ENSEMBL: ENSMUSP00000117858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000106069] [ENSMUST00000148670] [ENSMUST00000173209]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026546
AA Change: I675N

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473
AA Change: I675N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106069
AA Change: I676N

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473
AA Change: I676N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132903
Predicted Effect possibly damaging
Transcript: ENSMUST00000148670
AA Change: I681N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473
AA Change: I681N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 1.8e-35 PFAM
Pfam:Reprolysin_5 193 371 3.6e-23 PFAM
Pfam:Reprolysin_4 193 384 6e-17 PFAM
Pfam:Reprolysin 195 394 8.2e-71 PFAM
Pfam:Reprolysin_2 214 384 5.8e-17 PFAM
Pfam:Reprolysin_3 218 339 1.7e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 612 2.21e-32 SMART
EGF 619 648 3.06e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156647
Predicted Effect probably benign
Transcript: ENSMUST00000173209
SMART Domains Protein: ENSMUSP00000133673
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185038
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: This gene encodes a member of the Adam family of proteins that contain the disintegrin and metalloprotease domains. The encoded protein is localized to the cell surface, where it is involved in the remodeling of extracellular matrix and cell migration. Mice lacking the encoded protein display persistent inflammation upon treatment with allergens. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological or pathological abnormalities. Mice homozygous for a different knock-out allele exhibit reduced osteoclast differentiation and calvarial fibrosis in response to TNF-alpha treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,393 F151L probably benign Het
4932438A13Rik C T 3: 37,022,466 Q3663* probably null Het
A130010J15Rik A G 1: 193,174,529 Y63C probably damaging Het
Abcb4 C A 5: 8,910,717 F266L probably damaging Het
Adgrf3 T A 5: 30,197,617 probably null Het
Ang2 A G 14: 51,195,517 V136A probably damaging Het
Ankar C T 1: 72,698,694 G110R probably damaging Het
Ap3b1 T C 13: 94,403,960 L130P probably damaging Het
Apc2 T G 10: 80,314,358 W1749G probably benign Het
Asb2 T C 12: 103,323,837 N565S possibly damaging Het
B3gnt7 C A 1: 86,305,557 T58K probably benign Het
Brpf1 T A 6: 113,320,447 N876K possibly damaging Het
Ccdc157 T C 11: 4,148,994 I69V possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh20 A T 1: 104,984,685 I555F probably damaging Het
Cfap73 T C 5: 120,629,664 D274G probably damaging Het
Chd5 T A 4: 152,377,746 I1310N probably damaging Het
Ckap2 T A 8: 22,168,895 I611F possibly damaging Het
Cpeb2 A G 5: 43,285,857 I964V possibly damaging Het
Ctbp2 C A 7: 133,023,558 probably null Het
Dhrs2 A T 14: 55,238,748 I142F probably damaging Het
Dnah5 T A 15: 28,420,955 probably null Het
Dst T C 1: 34,212,309 S1822P probably damaging Het
Ect2 T C 3: 27,126,963 K581E probably damaging Het
Edem1 C T 6: 108,841,697 T222M probably damaging Het
Eif2ak1 A G 5: 143,901,803 M592V probably damaging Het
Endou T G 15: 97,726,539 D49A probably damaging Het
Ensa A G 3: 95,622,554 probably benign Het
Evc2 G T 5: 37,387,031 R708L probably damaging Het
Fam120b T A 17: 15,422,962 C668S probably damaging Het
Fam135a A T 1: 24,028,754 C798* probably null Het
Fam135b T C 15: 71,462,951 D798G probably benign Het
Fam208a A T 14: 27,461,095 I504L probably benign Het
Fshb A C 2: 107,057,282 *131E probably null Het
G3bp2 C T 5: 92,054,909 V441M possibly damaging Het
Galnt6 A T 15: 100,699,224 F354I probably damaging Het
Gm1123 C A 9: 99,023,240 probably null Het
Gm1123 A T 9: 99,023,241 probably null Het
Gm15130 T C 2: 111,142,862 N115S unknown Het
Gm7104 A G 12: 88,285,995 noncoding transcript Het
Gm9762 A T 3: 78,966,421 noncoding transcript Het
Grip2 A G 6: 91,779,182 V508A probably damaging Het
Grip2 T C 6: 91,779,192 T505A probably damaging Het
Haus4 A G 14: 54,549,892 probably null Het
Herc1 T A 9: 66,501,206 D4571E probably benign Het
Hnrnpk T A 13: 58,399,136 probably benign Het
Ica1l T C 1: 60,028,162 Y23C probably damaging Het
Kansl2-ps A G 7: 72,673,133 noncoding transcript Het
Kcnma1 T C 14: 23,363,836 D833G probably damaging Het
Kmt2e A T 5: 23,482,441 I430F possibly damaging Het
Lama2 C A 10: 27,118,531 R1794L possibly damaging Het
Mcpt1 T A 14: 56,018,680 F59I probably damaging Het
Mib2 G T 4: 155,655,365 T783K possibly damaging Het
Nlrp4g T C 9: 124,349,788 noncoding transcript Het
Obscn T C 11: 59,036,043 I6352V possibly damaging Het
Olfr1245 A T 2: 89,575,047 H226Q probably benign Het
Olfr1456-ps1 T A 19: 13,078,861 noncoding transcript Het
Olfr531 C T 7: 140,400,159 A296T probably damaging Het
Olfr68 T C 7: 103,777,668 I226V probably benign Het
Olfr728 T A 14: 50,140,033 N202I possibly damaging Het
Olfr728 T G 14: 50,140,034 N202H probably benign Het
Pcdh10 G A 3: 45,380,637 R462H probably damaging Het
Pcdhga12 C A 18: 37,766,551 N145K probably damaging Het
Pik3r6 T A 11: 68,544,775 L613Q probably damaging Het
Pknox2 T C 9: 36,909,720 D282G probably damaging Het
Plod2 T G 9: 92,606,531 Y624* probably null Het
Prkd3 C A 17: 78,956,614 V684F probably damaging Het
Ptpn1 T A 2: 167,974,160 V198D probably damaging Het
Ptpn12 G T 5: 20,998,589 P397Q probably benign Het
Rad1 C A 15: 10,493,126 probably benign Het
Rasl11a A G 5: 146,847,015 D90G probably benign Het
Rnf181 A G 6: 72,360,560 probably benign Het
Ryr3 T C 2: 112,757,639 I2652M possibly damaging Het
Siglecg C T 7: 43,411,871 probably benign Het
Slc22a3 T C 17: 12,507,195 S44G probably benign Het
Slc38a1 A T 15: 96,576,782 F463I probably damaging Het
Smg1 A T 7: 118,156,731 probably benign Het
Syk T C 13: 52,612,259 probably benign Het
Tbc1d5 T C 17: 50,800,165 I454M probably benign Het
Tmed6 C A 8: 107,063,730 D146Y probably damaging Het
Tmem132e A T 11: 82,444,851 K828* probably null Het
Tmprss15 A T 16: 79,054,124 S294T probably damaging Het
Trp53bp1 A G 2: 121,207,879 S1493P probably damaging Het
Tshb A T 3: 102,778,175 I46N probably damaging Het
Tspan11 T C 6: 127,938,220 V99A probably benign Het
Ttn T C 2: 76,715,561 T24176A probably benign Het
Vmn1r8 T C 6: 57,035,967 M1T probably null Het
Vmn2r104 A T 17: 20,040,768 Y464* probably null Het
Vmn2r110 T C 17: 20,596,196 T22A probably benign Het
Vmn2r17 T A 5: 109,452,849 I671K probably damaging Het
Zbtb21 T C 16: 97,951,266 N606D probably damaging Het
Zfy2 A T Y: 2,121,477 S139T probably benign Het
Zkscan17 G A 11: 59,503,025 R156* probably null Het
Zp2 A G 7: 120,138,318 V248A probably benign Het
Other mutations in Adam8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Adam8 APN 7 139987245 missense probably damaging 1.00
IGL02044:Adam8 APN 7 139982822 missense possibly damaging 0.85
IGL02228:Adam8 APN 7 139988806 splice site probably null
IGL02257:Adam8 APN 7 139987648 missense possibly damaging 0.88
IGL03101:Adam8 APN 7 139988543 missense possibly damaging 0.56
R0320:Adam8 UTSW 7 139986442 missense probably damaging 1.00
R0384:Adam8 UTSW 7 139986812 unclassified probably benign
R1169:Adam8 UTSW 7 139983929 missense probably benign 0.11
R1340:Adam8 UTSW 7 139991377 missense probably damaging 0.99
R1699:Adam8 UTSW 7 139983311 missense possibly damaging 0.72
R3725:Adam8 UTSW 7 139983868 missense possibly damaging 0.63
R3874:Adam8 UTSW 7 139987607 missense probably damaging 1.00
R4716:Adam8 UTSW 7 139983938 missense probably benign 0.31
R4907:Adam8 UTSW 7 139989373 missense probably benign 0.03
R5345:Adam8 UTSW 7 139987639 missense probably benign 0.03
R5579:Adam8 UTSW 7 139988984 missense probably benign 0.03
R5696:Adam8 UTSW 7 139989246 missense probably benign 0.03
R5805:Adam8 UTSW 7 139985881 missense probably damaging 1.00
R5948:Adam8 UTSW 7 139987884 missense probably benign 0.07
R5991:Adam8 UTSW 7 139990287 missense probably damaging 1.00
R6280:Adam8 UTSW 7 139984807 missense probably damaging 0.99
R6456:Adam8 UTSW 7 139986788 missense possibly damaging 0.96
R7098:Adam8 UTSW 7 139979499 missense possibly damaging 0.53
R7105:Adam8 UTSW 7 139990055 missense probably benign 0.00
R7334:Adam8 UTSW 7 139988990 missense probably damaging 1.00
R7342:Adam8 UTSW 7 139986391 missense probably benign 0.00
R7382:Adam8 UTSW 7 139990107 missense possibly damaging 0.74
R7425:Adam8 UTSW 7 139992481 unclassified probably benign
R7507:Adam8 UTSW 7 139987178 critical splice donor site probably null
R7637:Adam8 UTSW 7 139985430 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGTTCAACACCCAGAGAGC -3'
(R):5'- CAGGCACTTGACCATATGTGG -3'

Sequencing Primer
(F):5'- AGAGCCCCAGGTTCCCTTATG -3'
(R):5'- TGTGGGACCCAGGACATG -3'
Posted On2015-11-11