Mutagenetix > Incidental Mutation

Incidental Mutation 'R4754:Ap3b1'

357840

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.459) question?

Stock #

R4754 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94403960 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 130 (L130P)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022196
AA Change: L130P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: L130P

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Meta Mutation Damage Score

0.8897

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (107/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	A	T	9: 105,144,393	F151L	probably benign	Het
4932438A13Rik	C	T	3: 37,022,466	Q3663*	probably null	Het
A130010J15Rik	A	G	1: 193,174,529	Y63C	probably damaging	Het
Abcb4	C	A	5: 8,910,717	F266L	probably damaging	Het
Adam8	A	T	7: 139,984,780	I681N	possibly damaging	Het
Adgrf3	T	A	5: 30,197,617		probably null	Het
Ang2	A	G	14: 51,195,517	V136A	probably damaging	Het
Ankar	C	T	1: 72,698,694	G110R	probably damaging	Het
Apc2	T	G	10: 80,314,358	W1749G	probably benign	Het
Asb2	T	C	12: 103,323,837	N565S	possibly damaging	Het
B3gnt7	C	A	1: 86,305,557	T58K	probably benign	Het
Brpf1	T	A	6: 113,320,447	N876K	possibly damaging	Het
Ccdc157	T	C	11: 4,148,994	I69V	possibly damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdh20	A	T	1: 104,984,685	I555F	probably damaging	Het
Cfap73	T	C	5: 120,629,664	D274G	probably damaging	Het
Chd5	T	A	4: 152,377,746	I1310N	probably damaging	Het
Ckap2	T	A	8: 22,168,895	I611F	possibly damaging	Het
Cpeb2	A	G	5: 43,285,857	I964V	possibly damaging	Het
Ctbp2	C	A	7: 133,023,558		probably null	Het
Dhrs2	A	T	14: 55,238,748	I142F	probably damaging	Het
Dnah5	T	A	15: 28,420,955		probably null	Het
Dst	T	C	1: 34,212,309	S1822P	probably damaging	Het
Ect2	T	C	3: 27,126,963	K581E	probably damaging	Het
Edem1	C	T	6: 108,841,697	T222M	probably damaging	Het
Eif2ak1	A	G	5: 143,901,803	M592V	probably damaging	Het
Endou	T	G	15: 97,726,539	D49A	probably damaging	Het
Ensa	A	G	3: 95,622,554		probably benign	Het
Evc2	G	T	5: 37,387,031	R708L	probably damaging	Het
Fam120b	T	A	17: 15,422,962	C668S	probably damaging	Het
Fam135a	A	T	1: 24,028,754	C798*	probably null	Het
Fam135b	T	C	15: 71,462,951	D798G	probably benign	Het
Fam208a	A	T	14: 27,461,095	I504L	probably benign	Het
Fshb	A	C	2: 107,057,282	*131E	probably null	Het
G3bp2	C	T	5: 92,054,909	V441M	possibly damaging	Het
Galnt6	A	T	15: 100,699,224	F354I	probably damaging	Het
Gm1123	C	A	9: 99,023,240		probably null	Het
Gm1123	A	T	9: 99,023,241		probably null	Het
Gm15130	T	C	2: 111,142,862	N115S	unknown	Het
Gm7104	A	G	12: 88,285,995		noncoding transcript	Het
Gm9762	A	T	3: 78,966,421		noncoding transcript	Het
Grip2	A	G	6: 91,779,182	V508A	probably damaging	Het
Grip2	T	C	6: 91,779,192	T505A	probably damaging	Het
Haus4	A	G	14: 54,549,892		probably null	Het
Herc1	T	A	9: 66,501,206	D4571E	probably benign	Het
Hnrnpk	T	A	13: 58,399,136		probably benign	Het
Ica1l	T	C	1: 60,028,162	Y23C	probably damaging	Het
Kansl2-ps	A	G	7: 72,673,133		noncoding transcript	Het
Kcnma1	T	C	14: 23,363,836	D833G	probably damaging	Het
Kmt2e	A	T	5: 23,482,441	I430F	possibly damaging	Het
Lama2	C	A	10: 27,118,531	R1794L	possibly damaging	Het
Mcpt1	T	A	14: 56,018,680	F59I	probably damaging	Het
Mib2	G	T	4: 155,655,365	T783K	possibly damaging	Het
Nlrp4g	T	C	9: 124,349,788		noncoding transcript	Het
Obscn	T	C	11: 59,036,043	I6352V	possibly damaging	Het
Olfr1245	A	T	2: 89,575,047	H226Q	probably benign	Het
Olfr1456-ps1	T	A	19: 13,078,861		noncoding transcript	Het
Olfr531	C	T	7: 140,400,159	A296T	probably damaging	Het
Olfr68	T	C	7: 103,777,668	I226V	probably benign	Het
Olfr728	T	A	14: 50,140,033	N202I	possibly damaging	Het
Olfr728	T	G	14: 50,140,034	N202H	probably benign	Het
Pcdh10	G	A	3: 45,380,637	R462H	probably damaging	Het
Pcdhga12	C	A	18: 37,766,551	N145K	probably damaging	Het
Pik3r6	T	A	11: 68,544,775	L613Q	probably damaging	Het
Pknox2	T	C	9: 36,909,720	D282G	probably damaging	Het
Plod2	T	G	9: 92,606,531	Y624*	probably null	Het
Prkd3	C	A	17: 78,956,614	V684F	probably damaging	Het
Ptpn1	T	A	2: 167,974,160	V198D	probably damaging	Het
Ptpn12	G	T	5: 20,998,589	P397Q	probably benign	Het
Rad1	C	A	15: 10,493,126		probably benign	Het
Rasl11a	A	G	5: 146,847,015	D90G	probably benign	Het
Rnf181	A	G	6: 72,360,560		probably benign	Het
Ryr3	T	C	2: 112,757,639	I2652M	possibly damaging	Het
Siglecg	C	T	7: 43,411,871		probably benign	Het
Slc22a3	T	C	17: 12,507,195	S44G	probably benign	Het
Slc38a1	A	T	15: 96,576,782	F463I	probably damaging	Het
Smg1	A	T	7: 118,156,731		probably benign	Het
Syk	T	C	13: 52,612,259		probably benign	Het
Tbc1d5	T	C	17: 50,800,165	I454M	probably benign	Het
Tmed6	C	A	8: 107,063,730	D146Y	probably damaging	Het
Tmem132e	A	T	11: 82,444,851	K828*	probably null	Het
Tmprss15	A	T	16: 79,054,124	S294T	probably damaging	Het
Trp53bp1	A	G	2: 121,207,879	S1493P	probably damaging	Het
Tshb	A	T	3: 102,778,175	I46N	probably damaging	Het
Tspan11	T	C	6: 127,938,220	V99A	probably benign	Het
Ttn	T	C	2: 76,715,561	T24176A	probably benign	Het
Vmn1r8	T	C	6: 57,035,967	M1T	probably null	Het
Vmn2r104	A	T	17: 20,040,768	Y464*	probably null	Het
Vmn2r110	T	C	17: 20,596,196	T22A	probably benign	Het
Vmn2r17	T	A	5: 109,452,849	I671K	probably damaging	Het
Zbtb21	T	C	16: 97,951,266	N606D	probably damaging	Het
Zfy2	A	T	Y: 2,121,477	S139T	probably benign	Het
Zkscan17	G	A	11: 59,503,025	R156*	probably null	Het
Zp2	A	G	7: 120,138,318	V248A	probably benign	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTGTTGAAAGTTACAGAGAC -3'
(R):5'- TACTTACGTGGCCAACAAGG -3'

Sequencing Primer
(F):5'- GAGCGATTAAAAGCCTTGTCC -3'
(R):5'- GCACCCACCTGTACAGCTTC -3'

Posted On

2015-11-11