Incidental Mutation 'R4754:Slc38a1'
ID357850
Institutional Source Beutler Lab
Gene Symbol Slc38a1
Ensembl Gene ENSMUSG00000023169
Gene Namesolute carrier family 38, member 1
SynonymsNAT2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R4754 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96571418-96642913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96576782 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 463 (F463I)
Ref Sequence ENSEMBL: ENSMUSP00000097833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088452] [ENSMUST00000088454] [ENSMUST00000100262]
Predicted Effect probably damaging
Transcript: ENSMUST00000088452
AA Change: F463I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085799
Gene: ENSMUSG00000023169
AA Change: F463I

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 6.1e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088454
AA Change: F463I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085801
Gene: ENSMUSG00000023169
AA Change: F463I

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100262
AA Change: F463I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097833
Gene: ENSMUSG00000023169
AA Change: F463I

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230756
Meta Mutation Damage Score 0.1613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Amino acid transporters play essential roles in the uptake of nutrients, production of energy, chemical metabolism, detoxification, and neurotransmitter cycling. SLC38A1 is an important transporter of glutamine, an intermediate in the detoxification of ammonia and the production of urea. Glutamine serves as a precursor for the synaptic transmitter, glutamate (Gu et al., 2001 [PubMed 11325958]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,393 F151L probably benign Het
4932438A13Rik C T 3: 37,022,466 Q3663* probably null Het
A130010J15Rik A G 1: 193,174,529 Y63C probably damaging Het
Abcb4 C A 5: 8,910,717 F266L probably damaging Het
Adam8 A T 7: 139,984,780 I681N possibly damaging Het
Adgrf3 T A 5: 30,197,617 probably null Het
Ang2 A G 14: 51,195,517 V136A probably damaging Het
Ankar C T 1: 72,698,694 G110R probably damaging Het
Ap3b1 T C 13: 94,403,960 L130P probably damaging Het
Apc2 T G 10: 80,314,358 W1749G probably benign Het
Asb2 T C 12: 103,323,837 N565S possibly damaging Het
B3gnt7 C A 1: 86,305,557 T58K probably benign Het
Brpf1 T A 6: 113,320,447 N876K possibly damaging Het
Ccdc157 T C 11: 4,148,994 I69V possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh20 A T 1: 104,984,685 I555F probably damaging Het
Cfap73 T C 5: 120,629,664 D274G probably damaging Het
Chd5 T A 4: 152,377,746 I1310N probably damaging Het
Ckap2 T A 8: 22,168,895 I611F possibly damaging Het
Cpeb2 A G 5: 43,285,857 I964V possibly damaging Het
Ctbp2 C A 7: 133,023,558 probably null Het
Dhrs2 A T 14: 55,238,748 I142F probably damaging Het
Dnah5 T A 15: 28,420,955 probably null Het
Dst T C 1: 34,212,309 S1822P probably damaging Het
Ect2 T C 3: 27,126,963 K581E probably damaging Het
Edem1 C T 6: 108,841,697 T222M probably damaging Het
Eif2ak1 A G 5: 143,901,803 M592V probably damaging Het
Endou T G 15: 97,726,539 D49A probably damaging Het
Ensa A G 3: 95,622,554 probably benign Het
Evc2 G T 5: 37,387,031 R708L probably damaging Het
Fam120b T A 17: 15,422,962 C668S probably damaging Het
Fam135a A T 1: 24,028,754 C798* probably null Het
Fam135b T C 15: 71,462,951 D798G probably benign Het
Fam208a A T 14: 27,461,095 I504L probably benign Het
Fshb A C 2: 107,057,282 *131E probably null Het
G3bp2 C T 5: 92,054,909 V441M possibly damaging Het
Galnt6 A T 15: 100,699,224 F354I probably damaging Het
Gm1123 C A 9: 99,023,240 probably null Het
Gm1123 A T 9: 99,023,241 probably null Het
Gm15130 T C 2: 111,142,862 N115S unknown Het
Gm7104 A G 12: 88,285,995 noncoding transcript Het
Gm9762 A T 3: 78,966,421 noncoding transcript Het
Grip2 A G 6: 91,779,182 V508A probably damaging Het
Grip2 T C 6: 91,779,192 T505A probably damaging Het
Haus4 A G 14: 54,549,892 probably null Het
Herc1 T A 9: 66,501,206 D4571E probably benign Het
Hnrnpk T A 13: 58,399,136 probably benign Het
Ica1l T C 1: 60,028,162 Y23C probably damaging Het
Kansl2-ps A G 7: 72,673,133 noncoding transcript Het
Kcnma1 T C 14: 23,363,836 D833G probably damaging Het
Kmt2e A T 5: 23,482,441 I430F possibly damaging Het
Lama2 C A 10: 27,118,531 R1794L possibly damaging Het
Mcpt1 T A 14: 56,018,680 F59I probably damaging Het
Mib2 G T 4: 155,655,365 T783K possibly damaging Het
Nlrp4g T C 9: 124,349,788 noncoding transcript Het
Obscn T C 11: 59,036,043 I6352V possibly damaging Het
Olfr1245 A T 2: 89,575,047 H226Q probably benign Het
Olfr1456-ps1 T A 19: 13,078,861 noncoding transcript Het
Olfr531 C T 7: 140,400,159 A296T probably damaging Het
Olfr68 T C 7: 103,777,668 I226V probably benign Het
Olfr728 T A 14: 50,140,033 N202I possibly damaging Het
Olfr728 T G 14: 50,140,034 N202H probably benign Het
Pcdh10 G A 3: 45,380,637 R462H probably damaging Het
Pcdhga12 C A 18: 37,766,551 N145K probably damaging Het
Pik3r6 T A 11: 68,544,775 L613Q probably damaging Het
Pknox2 T C 9: 36,909,720 D282G probably damaging Het
Plod2 T G 9: 92,606,531 Y624* probably null Het
Prkd3 C A 17: 78,956,614 V684F probably damaging Het
Ptpn1 T A 2: 167,974,160 V198D probably damaging Het
Ptpn12 G T 5: 20,998,589 P397Q probably benign Het
Rad1 C A 15: 10,493,126 probably benign Het
Rasl11a A G 5: 146,847,015 D90G probably benign Het
Rnf181 A G 6: 72,360,560 probably benign Het
Ryr3 T C 2: 112,757,639 I2652M possibly damaging Het
Siglecg C T 7: 43,411,871 probably benign Het
Slc22a3 T C 17: 12,507,195 S44G probably benign Het
Smg1 A T 7: 118,156,731 probably benign Het
Syk T C 13: 52,612,259 probably benign Het
Tbc1d5 T C 17: 50,800,165 I454M probably benign Het
Tmed6 C A 8: 107,063,730 D146Y probably damaging Het
Tmem132e A T 11: 82,444,851 K828* probably null Het
Tmprss15 A T 16: 79,054,124 S294T probably damaging Het
Trp53bp1 A G 2: 121,207,879 S1493P probably damaging Het
Tshb A T 3: 102,778,175 I46N probably damaging Het
Tspan11 T C 6: 127,938,220 V99A probably benign Het
Ttn T C 2: 76,715,561 T24176A probably benign Het
Vmn1r8 T C 6: 57,035,967 M1T probably null Het
Vmn2r104 A T 17: 20,040,768 Y464* probably null Het
Vmn2r110 T C 17: 20,596,196 T22A probably benign Het
Vmn2r17 T A 5: 109,452,849 I671K probably damaging Het
Zbtb21 T C 16: 97,951,266 N606D probably damaging Het
Zfy2 A T Y: 2,121,477 S139T probably benign Het
Zkscan17 G A 11: 59,503,025 R156* probably null Het
Zp2 A G 7: 120,138,318 V248A probably benign Het
Other mutations in Slc38a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc38a1 APN 15 96585623 missense possibly damaging 0.89
IGL01376:Slc38a1 APN 15 96585556 missense probably damaging 1.00
IGL01920:Slc38a1 APN 15 96586897 missense probably benign
IGL01993:Slc38a1 APN 15 96624046 missense probably damaging 1.00
IGL02201:Slc38a1 APN 15 96578798 missense probably damaging 1.00
IGL03074:Slc38a1 APN 15 96592524 missense possibly damaging 0.72
IGL03370:Slc38a1 APN 15 96579347 missense possibly damaging 0.93
R0918:Slc38a1 UTSW 15 96609862 missense probably damaging 1.00
R1506:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R1510:Slc38a1 UTSW 15 96609860 missense probably damaging 1.00
R1713:Slc38a1 UTSW 15 96578760 missense probably damaging 1.00
R1721:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R1867:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R4254:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R4255:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R5548:Slc38a1 UTSW 15 96590474 missense probably damaging 1.00
R5610:Slc38a1 UTSW 15 96616141 critical splice donor site probably null
R6235:Slc38a1 UTSW 15 96578792 missense probably benign 0.36
R6288:Slc38a1 UTSW 15 96586878 missense probably benign 0.12
R7904:Slc38a1 UTSW 15 96624040 missense possibly damaging 0.95
R8195:Slc38a1 UTSW 15 96592566 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGAGTCTCTGTGTGGCAACC -3'
(R):5'- GTTCAGCCACGATCATAACG -3'

Sequencing Primer
(F):5'- TCTGTGTGGCAACCCGAGAG -3'
(R):5'- GTTCAGCCACGATCATAACGAACTTC -3'
Posted On2015-11-11