Incidental Mutation 'R0306:Trpc4ap'
ID35786
Institutional Source Beutler Lab
Gene Symbol Trpc4ap
Ensembl Gene ENSMUSG00000038324
Gene Nametransient receptor potential cation channel, subfamily C, member 4 associated protein
SynonymsD2Ertd113e, Trrp4ap, 4833429F06Rik, Trp4-associated protein TAP1
MMRRC Submission 038517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0306 (G1)
Quality Score202
Status Validated
Chromosome2
Chromosomal Location155634271-155692384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155636260 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 662 (V662A)
Ref Sequence ENSEMBL: ENSMUSP00000037574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000092995] [ENSMUST00000103140]
Predicted Effect probably benign
Transcript: ENSMUST00000041059
AA Change: V662A

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324
AA Change: V662A

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092995
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103140
AA Change: V654A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324
AA Change: V654A

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154656
Meta Mutation Damage Score 0.0958 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (61/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,179,889 V270A probably damaging Het
BC028528 C T 3: 95,889,820 probably benign Het
Bspry T C 4: 62,496,157 F329S probably damaging Het
Cd209a A G 8: 3,745,535 Y120H probably benign Het
Ces1f T C 8: 93,276,544 probably benign Het
Cfap52 T C 11: 67,954,070 N58D probably benign Het
Cfap74 G A 4: 155,465,439 probably benign Het
Chst8 T C 7: 34,675,298 E372G probably benign Het
Ddx49 A G 8: 70,294,672 probably benign Het
Ddx52 G T 11: 83,944,648 L133F probably benign Het
Defb26 T A 2: 152,507,968 I131F unknown Het
Dip2c T A 13: 9,604,599 S719T probably benign Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Doxl2 T C 6: 48,976,086 V315A probably damaging Het
Dytn G A 1: 63,685,113 P3S possibly damaging Het
Fmn2 T C 1: 174,609,484 probably benign Het
Gal3st1 T A 11: 3,998,546 L251Q probably damaging Het
Gm19684 A T 17: 36,127,408 probably benign Het
Il15 T A 8: 82,334,454 probably benign Het
Jag1 C T 2: 137,085,935 G852D probably damaging Het
Kbtbd4 A G 2: 90,914,186 probably benign Het
Kdm3b C A 18: 34,804,017 Q451K probably benign Het
Lrfn2 A T 17: 49,096,255 I469F probably damaging Het
Mep1a A T 17: 43,502,643 probably benign Het
Morn5 T C 2: 36,054,974 F70S probably damaging Het
Nav2 C A 7: 49,545,903 P1009Q probably benign Het
Noc3l T C 19: 38,807,650 Y334C probably damaging Het
Nsun4 A T 4: 116,052,822 Y180* probably null Het
Nup210l T C 3: 90,207,368 I1750T probably benign Het
Olfr1044 T A 2: 86,171,716 I34F possibly damaging Het
Olfr473 A T 7: 107,933,700 Y60F probably damaging Het
Olfr571 A T 7: 102,909,803 I12N probably benign Het
Parp14 A G 16: 35,856,574 L1008P probably benign Het
Paxbp1 A G 16: 91,022,115 V759A possibly damaging Het
Prdm10 C A 9: 31,316,224 Q42K probably damaging Het
Prkcsh T C 9: 22,006,526 probably benign Het
Psmg1 A G 16: 95,987,340 C138R probably damaging Het
Ptprb T C 10: 116,343,988 M1437T probably benign Het
Ryr3 A G 2: 112,775,655 probably null Het
Serpinf1 T C 11: 75,413,935 Y200C probably damaging Het
Shox2 T C 3: 66,973,834 H130R probably damaging Het
Slc22a1 A G 17: 12,662,598 F335L probably benign Het
Slc44a5 A G 3: 154,270,001 N683S probably damaging Het
Slc9a9 A T 9: 95,137,934 T519S probably benign Het
Smarca2 T A 19: 26,640,613 L348Q probably damaging Het
Sorbs1 T C 19: 40,344,411 D521G possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Srp19 T C 18: 34,334,576 probably benign Het
Stk35 T A 2: 129,801,763 Y222* probably null Het
Syt10 T G 15: 89,826,988 K114T probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Ttll4 G A 1: 74,696,757 R1066Q probably benign Het
Tulp2 C T 7: 45,518,576 probably benign Het
Unc5b C A 10: 60,779,658 probably benign Het
Vmn1r230 T A 17: 20,846,633 I28K possibly damaging Het
Vmn2r118 A C 17: 55,608,616 F445V possibly damaging Het
Zfp142 C T 1: 74,570,182 E1485K probably damaging Het
Zfp819 C A 7: 43,617,197 A292E possibly damaging Het
Other mutations in Trpc4ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Trpc4ap APN 2 155639535 missense possibly damaging 0.90
IGL02149:Trpc4ap APN 2 155639547 missense probably damaging 0.97
IGL02313:Trpc4ap APN 2 155650468 missense probably damaging 1.00
IGL02408:Trpc4ap APN 2 155671069 missense possibly damaging 0.71
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0255:Trpc4ap UTSW 2 155657946 splice site probably benign
R0382:Trpc4ap UTSW 2 155636230 missense probably damaging 1.00
R0525:Trpc4ap UTSW 2 155640478 missense possibly damaging 0.85
R1184:Trpc4ap UTSW 2 155645070 splice site probably benign
R1711:Trpc4ap UTSW 2 155657744 missense probably benign 0.01
R2113:Trpc4ap UTSW 2 155657936 missense probably damaging 0.99
R3810:Trpc4ap UTSW 2 155643435 missense probably damaging 1.00
R4384:Trpc4ap UTSW 2 155640507 missense possibly damaging 0.85
R4664:Trpc4ap UTSW 2 155672997 missense probably benign 0.04
R4690:Trpc4ap UTSW 2 155635133 missense probably damaging 0.97
R5347:Trpc4ap UTSW 2 155672988 critical splice donor site probably null
R5655:Trpc4ap UTSW 2 155653627 missense possibly damaging 0.95
R5689:Trpc4ap UTSW 2 155671035 splice site probably null
R5828:Trpc4ap UTSW 2 155635210 intron probably benign
R5894:Trpc4ap UTSW 2 155666213 missense probably benign 0.11
R6056:Trpc4ap UTSW 2 155671074 missense probably damaging 1.00
R6289:Trpc4ap UTSW 2 155663707 missense possibly damaging 0.90
R6539:Trpc4ap UTSW 2 155636258 missense probably benign 0.00
R6682:Trpc4ap UTSW 2 155637767 critical splice acceptor site probably null
R7022:Trpc4ap UTSW 2 155657822 missense probably benign 0.01
R7031:Trpc4ap UTSW 2 155692215 missense unknown
X0018:Trpc4ap UTSW 2 155653564 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGACAAAACTCAGGTCCAAGC -3'
(R):5'- TTGCATACGCTGAAGAGCCACC -3'

Sequencing Primer
(F):5'- tgagcacatggggaagaac -3'
(R):5'- tggaagagtagcaggggg -3'
Posted On2013-05-09