Incidental Mutation 'R4754:Prkd3'
ID357861
Institutional Source Beutler Lab
Gene Symbol Prkd3
Ensembl Gene ENSMUSG00000024070
Gene Nameprotein kinase D3
SynonymsPrkcn, 5730497N19Rik, PKD3, 4930557O20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4754 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location78949405-79020816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78956614 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 684 (V684F)
Ref Sequence ENSEMBL: ENSMUSP00000132004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003191] [ENSMUST00000118768] [ENSMUST00000119284] [ENSMUST00000168887]
Predicted Effect probably damaging
Transcript: ENSMUST00000003191
AA Change: V684F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003191
Gene: ENSMUSG00000024070
AA Change: V684F

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118768
AA Change: V590F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113232
Gene: ENSMUSG00000024070
AA Change: V590F

DomainStartEndE-ValueType
C1 60 109 1.95e-13 SMART
C1 177 226 1.26e-16 SMART
PH 322 439 1.18e-10 SMART
S_TKc 481 737 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119284
AA Change: V685F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113395
Gene: ENSMUSG00000024070
AA Change: V685F

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 576 832 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168887
AA Change: V684F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132004
Gene: ENSMUSG00000024070
AA Change: V684F

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Meta Mutation Damage Score 0.1318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the multigene protein kinase D family of serine/threonine kinases, which bind diacylglycerol and phorbol esters. Members of this family are characterized by an N-terminal regulatory domain comprised of a tandem repeat of cysteine-rich zinc-finger motifs and a pleckstrin domain. The C-terminal region contains the catalytic domain and is distantly related to calcium-regulated kinases. Catalytic activity of this enzyme promotes its nuclear localization. This protein has been implicated in a variety of functions including negative regulation of human airway epithelial barrier formation, growth regulation of breast and prostate cancer cells, and vesicle trafficking. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal vertebral trabecular bone morphology and abnormal femur morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,393 F151L probably benign Het
4932438A13Rik C T 3: 37,022,466 Q3663* probably null Het
A130010J15Rik A G 1: 193,174,529 Y63C probably damaging Het
Abcb4 C A 5: 8,910,717 F266L probably damaging Het
Adam8 A T 7: 139,984,780 I681N possibly damaging Het
Adgrf3 T A 5: 30,197,617 probably null Het
Ang2 A G 14: 51,195,517 V136A probably damaging Het
Ankar C T 1: 72,698,694 G110R probably damaging Het
Ap3b1 T C 13: 94,403,960 L130P probably damaging Het
Apc2 T G 10: 80,314,358 W1749G probably benign Het
Asb2 T C 12: 103,323,837 N565S possibly damaging Het
B3gnt7 C A 1: 86,305,557 T58K probably benign Het
Brpf1 T A 6: 113,320,447 N876K possibly damaging Het
Ccdc157 T C 11: 4,148,994 I69V possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh20 A T 1: 104,984,685 I555F probably damaging Het
Cfap73 T C 5: 120,629,664 D274G probably damaging Het
Chd5 T A 4: 152,377,746 I1310N probably damaging Het
Ckap2 T A 8: 22,168,895 I611F possibly damaging Het
Cpeb2 A G 5: 43,285,857 I964V possibly damaging Het
Ctbp2 C A 7: 133,023,558 probably null Het
Dhrs2 A T 14: 55,238,748 I142F probably damaging Het
Dnah5 T A 15: 28,420,955 probably null Het
Dst T C 1: 34,212,309 S1822P probably damaging Het
Ect2 T C 3: 27,126,963 K581E probably damaging Het
Edem1 C T 6: 108,841,697 T222M probably damaging Het
Eif2ak1 A G 5: 143,901,803 M592V probably damaging Het
Endou T G 15: 97,726,539 D49A probably damaging Het
Ensa A G 3: 95,622,554 probably benign Het
Evc2 G T 5: 37,387,031 R708L probably damaging Het
Fam120b T A 17: 15,422,962 C668S probably damaging Het
Fam135a A T 1: 24,028,754 C798* probably null Het
Fam135b T C 15: 71,462,951 D798G probably benign Het
Fam208a A T 14: 27,461,095 I504L probably benign Het
Fshb A C 2: 107,057,282 *131E probably null Het
G3bp2 C T 5: 92,054,909 V441M possibly damaging Het
Galnt6 A T 15: 100,699,224 F354I probably damaging Het
Gm1123 C A 9: 99,023,240 probably null Het
Gm1123 A T 9: 99,023,241 probably null Het
Gm15130 T C 2: 111,142,862 N115S unknown Het
Gm7104 A G 12: 88,285,995 noncoding transcript Het
Gm9762 A T 3: 78,966,421 noncoding transcript Het
Grip2 A G 6: 91,779,182 V508A probably damaging Het
Grip2 T C 6: 91,779,192 T505A probably damaging Het
Haus4 A G 14: 54,549,892 probably null Het
Herc1 T A 9: 66,501,206 D4571E probably benign Het
Hnrnpk T A 13: 58,399,136 probably benign Het
Ica1l T C 1: 60,028,162 Y23C probably damaging Het
Kansl2-ps A G 7: 72,673,133 noncoding transcript Het
Kcnma1 T C 14: 23,363,836 D833G probably damaging Het
Kmt2e A T 5: 23,482,441 I430F possibly damaging Het
Lama2 C A 10: 27,118,531 R1794L possibly damaging Het
Mcpt1 T A 14: 56,018,680 F59I probably damaging Het
Mib2 G T 4: 155,655,365 T783K possibly damaging Het
Nlrp4g T C 9: 124,349,788 noncoding transcript Het
Obscn T C 11: 59,036,043 I6352V possibly damaging Het
Olfr1245 A T 2: 89,575,047 H226Q probably benign Het
Olfr1456-ps1 T A 19: 13,078,861 noncoding transcript Het
Olfr531 C T 7: 140,400,159 A296T probably damaging Het
Olfr68 T C 7: 103,777,668 I226V probably benign Het
Olfr728 T A 14: 50,140,033 N202I possibly damaging Het
Olfr728 T G 14: 50,140,034 N202H probably benign Het
Pcdh10 G A 3: 45,380,637 R462H probably damaging Het
Pcdhga12 C A 18: 37,766,551 N145K probably damaging Het
Pik3r6 T A 11: 68,544,775 L613Q probably damaging Het
Pknox2 T C 9: 36,909,720 D282G probably damaging Het
Plod2 T G 9: 92,606,531 Y624* probably null Het
Ptpn1 T A 2: 167,974,160 V198D probably damaging Het
Ptpn12 G T 5: 20,998,589 P397Q probably benign Het
Rad1 C A 15: 10,493,126 probably benign Het
Rasl11a A G 5: 146,847,015 D90G probably benign Het
Rnf181 A G 6: 72,360,560 probably benign Het
Ryr3 T C 2: 112,757,639 I2652M possibly damaging Het
Siglecg C T 7: 43,411,871 probably benign Het
Slc22a3 T C 17: 12,507,195 S44G probably benign Het
Slc38a1 A T 15: 96,576,782 F463I probably damaging Het
Smg1 A T 7: 118,156,731 probably benign Het
Syk T C 13: 52,612,259 probably benign Het
Tbc1d5 T C 17: 50,800,165 I454M probably benign Het
Tmed6 C A 8: 107,063,730 D146Y probably damaging Het
Tmem132e A T 11: 82,444,851 K828* probably null Het
Tmprss15 A T 16: 79,054,124 S294T probably damaging Het
Trp53bp1 A G 2: 121,207,879 S1493P probably damaging Het
Tshb A T 3: 102,778,175 I46N probably damaging Het
Tspan11 T C 6: 127,938,220 V99A probably benign Het
Ttn T C 2: 76,715,561 T24176A probably benign Het
Vmn1r8 T C 6: 57,035,967 M1T probably null Het
Vmn2r104 A T 17: 20,040,768 Y464* probably null Het
Vmn2r110 T C 17: 20,596,196 T22A probably benign Het
Vmn2r17 T A 5: 109,452,849 I671K probably damaging Het
Zbtb21 T C 16: 97,951,266 N606D probably damaging Het
Zfy2 A T Y: 2,121,477 S139T probably benign Het
Zkscan17 G A 11: 59,503,025 R156* probably null Het
Zp2 A G 7: 120,138,318 V248A probably benign Het
Other mutations in Prkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Prkd3 APN 17 78954523 missense probably benign 0.00
IGL01775:Prkd3 APN 17 79012760 missense probably damaging 1.00
IGL01875:Prkd3 APN 17 78957206 missense possibly damaging 0.95
IGL01892:Prkd3 APN 17 78972501 missense probably benign 0.13
FR4304:Prkd3 UTSW 17 78975820 intron probably null
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0374:Prkd3 UTSW 17 78957215 missense probably null 1.00
R0688:Prkd3 UTSW 17 78957233 missense probably damaging 0.99
R1112:Prkd3 UTSW 17 78966408 missense probably damaging 1.00
R1364:Prkd3 UTSW 17 78957258 missense probably damaging 1.00
R1382:Prkd3 UTSW 17 78957245 missense probably damaging 1.00
R1459:Prkd3 UTSW 17 78971367 missense probably damaging 1.00
R1522:Prkd3 UTSW 17 78952696 missense probably damaging 1.00
R1645:Prkd3 UTSW 17 78956520 critical splice donor site probably null
R2035:Prkd3 UTSW 17 78975373 critical splice donor site probably null
R2187:Prkd3 UTSW 17 78975554 missense probably benign
R2250:Prkd3 UTSW 17 78968078 missense probably benign 0.15
R2850:Prkd3 UTSW 17 78954596 missense possibly damaging 0.89
R3625:Prkd3 UTSW 17 78985304 missense probably damaging 1.00
R3773:Prkd3 UTSW 17 78959106 missense possibly damaging 0.52
R3973:Prkd3 UTSW 17 78959141 splice site probably benign
R4089:Prkd3 UTSW 17 78971388 missense possibly damaging 0.64
R4407:Prkd3 UTSW 17 78983558 missense probably damaging 1.00
R4453:Prkd3 UTSW 17 78983546 missense probably damaging 1.00
R4697:Prkd3 UTSW 17 78961171 missense probably benign 0.02
R4715:Prkd3 UTSW 17 78951937 missense possibly damaging 0.73
R4955:Prkd3 UTSW 17 78952727 missense probably null 0.95
R5412:Prkd3 UTSW 17 78954711 missense possibly damaging 0.85
R6163:Prkd3 UTSW 17 78966355 missense possibly damaging 0.94
R6280:Prkd3 UTSW 17 78981931 missense probably damaging 0.97
R7074:Prkd3 UTSW 17 78974807 nonsense probably null
R7153:Prkd3 UTSW 17 78966355 missense probably benign 0.04
R7335:Prkd3 UTSW 17 78954566 missense probably damaging 0.99
R7492:Prkd3 UTSW 17 78962545 nonsense probably null
R7819:Prkd3 UTSW 17 78972501 missense probably benign 0.13
X0063:Prkd3 UTSW 17 78956613 missense probably damaging 1.00
X0066:Prkd3 UTSW 17 78961182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGCTGCTGCCTCAGAC -3'
(R):5'- TGAAGTTGGTCCTCTGCAAG -3'

Sequencing Primer
(F):5'- GACTACAATGGTTGTATGCAGAGCTC -3'
(R):5'- TCTGCAAGGACAGCTGATC -3'
Posted On2015-11-11