Incidental Mutation 'R4755:Cfap65'
ID 357865
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 042033-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # R4755 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74967520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 186 (E186G)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: E186G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: E186G

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139950
Meta Mutation Damage Score 0.1765 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,733,280 (GRCm39) noncoding transcript Het
Aadacl2fm1 C T 3: 59,843,735 (GRCm39) A143V probably benign Het
Accs T C 2: 93,671,682 (GRCm39) E236G probably damaging Het
Agrn C T 4: 156,257,979 (GRCm39) probably benign Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Akap5 C A 12: 76,374,581 (GRCm39) C4* probably null Het
Amotl2 A T 9: 102,597,679 (GRCm39) H146L probably damaging Het
Ank1 A G 8: 23,594,990 (GRCm39) N666S probably damaging Het
Atp10d A T 5: 72,403,509 (GRCm39) T373S probably benign Het
Bpifb9b T A 2: 154,161,614 (GRCm39) M582K probably benign Het
Brca2 T A 5: 150,483,452 (GRCm39) probably null Het
Ccdc149 A G 5: 52,561,493 (GRCm39) V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdk5rap2 A G 4: 70,156,662 (GRCm39) S1617P probably damaging Het
Cenpk A T 13: 104,367,379 (GRCm39) M37L probably benign Het
Cenpk A T 13: 104,386,020 (GRCm39) H305L probably benign Het
Ces5a C A 8: 94,262,305 (GRCm39) A11S probably benign Het
Cfh T A 1: 140,016,546 (GRCm39) I593F probably damaging Het
Clstn2 C T 9: 97,327,726 (GRCm39) V961I probably benign Het
Cog5 T A 12: 31,919,405 (GRCm39) probably null Het
Col4a4 T C 1: 82,518,895 (GRCm39) D100G unknown Het
Cyp3a41a T C 5: 145,652,316 (GRCm39) D61G probably damaging Het
Dnah10 A G 5: 124,824,809 (GRCm39) N655S probably benign Het
Dnai1 C G 4: 41,610,269 (GRCm39) T295R probably damaging Het
Dnajc6 C T 4: 101,407,996 (GRCm39) A44V probably damaging Het
Eif4enif1 A T 11: 3,194,016 (GRCm39) D960V probably damaging Het
Fam167b C T 4: 129,472,135 (GRCm39) G12R probably damaging Het
Fam20b A T 1: 156,515,066 (GRCm39) Y266* probably null Het
Fer1l6 T A 15: 58,512,060 (GRCm39) V1509D probably benign Het
Fhad1 A T 4: 141,655,794 (GRCm39) I105N probably damaging Het
Fmo2 T C 1: 162,716,374 (GRCm39) D71G probably damaging Het
Folr2 T C 7: 101,493,006 (GRCm39) T6A possibly damaging Het
Fry A C 5: 150,321,719 (GRCm39) E1018A probably damaging Het
Gas2l2 A G 11: 83,320,193 (GRCm39) I21T probably damaging Het
Gfra1 T C 19: 58,441,676 (GRCm39) Y85C probably damaging Het
Gpld1 A T 13: 25,163,671 (GRCm39) Y43F probably benign Het
Gpld1 T A 13: 25,163,675 (GRCm39) Y44* probably null Het
Grid2 A G 6: 63,885,972 (GRCm39) T123A probably benign Het
Grina T C 15: 76,133,442 (GRCm39) L305P probably damaging Het
Gucy1a1 G A 3: 82,002,102 (GRCm39) A659V probably benign Het
H2-T10 T A 17: 36,429,837 (GRCm39) K319* probably null Het
Hey2 A T 10: 30,710,300 (GRCm39) V151E probably benign Het
Ighv1-69 G A 12: 115,587,178 (GRCm39) T13I probably benign Het
Il1rap C A 16: 26,541,532 (GRCm39) A591E probably benign Het
Ildr1 T C 16: 36,542,383 (GRCm39) L261P probably benign Het
Jak1 A G 4: 101,031,354 (GRCm39) Y463H probably damaging Het
Lrp1b T C 2: 41,159,285 (GRCm39) I1666V probably benign Het
Lrp1b T A 2: 41,361,028 (GRCm39) T592S probably benign Het
Lrrc36 A G 8: 106,178,776 (GRCm39) T445A possibly damaging Het
Ly9 G A 1: 171,434,806 (GRCm39) S29F probably damaging Het
Mapk7 A C 11: 61,381,669 (GRCm39) C32W probably damaging Het
Marchf10 C T 11: 105,255,302 (GRCm39) probably benign Het
Mier2 A T 10: 79,385,031 (GRCm39) M119K probably damaging Het
Mpv17 A T 5: 31,303,326 (GRCm39) C59* probably null Het
Mrpl27 G A 11: 94,544,659 (GRCm39) probably benign Het
Myo18b G A 5: 113,022,340 (GRCm39) Q351* probably null Het
Myo1a A G 10: 127,551,557 (GRCm39) I704M probably damaging Het
Nadsyn1 A G 7: 143,360,650 (GRCm39) C373R probably damaging Het
Nckipsd C A 9: 108,691,938 (GRCm39) A513E probably benign Het
Neb T C 2: 52,110,221 (GRCm39) D209G probably damaging Het
Nkapl T A 13: 21,652,457 (GRCm39) Q52L unknown Het
Nptx2 G A 5: 144,483,250 (GRCm39) S126N probably benign Het
Or2a7 G A 6: 43,150,977 (GRCm39) S19N probably benign Het
Or52d3 T A 7: 104,229,268 (GRCm39) Y138* probably null Het
Or7g17 A T 9: 18,768,476 (GRCm39) H185L probably benign Het
Or8b52 A G 9: 38,577,128 (GRCm39) V4A probably benign Het
Pclo A T 5: 14,764,362 (GRCm39) R4278S unknown Het
Pcnx1 T G 12: 81,997,068 (GRCm39) L988R probably damaging Het
Prl2c5 C A 13: 13,363,970 (GRCm39) N75K probably benign Het
Prpf19 T G 19: 10,875,154 (GRCm39) probably benign Het
Ralgapa1 A G 12: 55,759,533 (GRCm39) S997P probably damaging Het
Rangap1 T C 15: 81,597,118 (GRCm39) T226A probably benign Het
Rimklb G A 6: 122,433,365 (GRCm39) L262F probably damaging Het
Rnf169 A G 7: 99,574,930 (GRCm39) M555T probably benign Het
Rp1l1 A T 14: 64,267,519 (GRCm39) D1035V probably benign Het
Rps23rg1 A T 8: 3,633,922 (GRCm39) S8C probably damaging Het
Scd2 T A 19: 44,289,791 (GRCm39) L262Q probably damaging Het
Scgb2b12 T A 7: 32,024,956 (GRCm39) M84L probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 G A 12: 82,419,160 (GRCm39) V613I possibly damaging Het
Slc25a23 T A 17: 57,359,794 (GRCm39) D67V possibly damaging Het
Slc25a39 C T 11: 102,297,492 (GRCm39) probably benign Het
Slc4a10 T A 2: 62,127,332 (GRCm39) F895Y probably damaging Het
Slc5a4a A C 10: 76,022,398 (GRCm39) K578Q probably benign Het
Slc6a13 G A 6: 121,302,008 (GRCm39) G197S probably damaging Het
Smarca2 A T 19: 26,631,883 (GRCm39) E566V possibly damaging Het
Sorbs3 A T 14: 70,421,548 (GRCm39) N594K probably benign Het
Spata22 A T 11: 73,236,582 (GRCm39) D296V probably damaging Het
Sphk2 G A 7: 45,363,058 (GRCm39) A11V possibly damaging Het
Spp1 A T 5: 104,583,081 (GRCm39) probably benign Het
Strn3 T A 12: 51,656,999 (GRCm39) I760L possibly damaging Het
Syk A T 13: 52,796,022 (GRCm39) Y539F probably benign Het
Tdpoz9-ps1 T C 3: 93,846,093 (GRCm39) probably null Het
Thsd7b T A 1: 130,138,001 (GRCm39) Y1560N probably benign Het
Tmod2 C A 9: 75,504,494 (GRCm39) E42* probably null Het
Tom1l1 T C 11: 90,575,942 (GRCm39) E30G probably damaging Het
Trav10 G A 14: 53,743,518 (GRCm39) A40T probably benign Het
Trav14-2 G A 14: 53,878,237 (GRCm39) probably benign Het
Tril T A 6: 53,795,449 (GRCm39) E591V probably damaging Het
Trp53bp1 T A 2: 121,059,087 (GRCm39) R179* probably null Het
Tspoap1 A T 11: 87,662,489 (GRCm39) D562V possibly damaging Het
Usp44 A T 10: 93,682,768 (GRCm39) H406L probably damaging Het
Vangl1 A G 3: 102,065,608 (GRCm39) I509T probably benign Het
Vax2 T G 6: 83,688,379 (GRCm39) L34W probably damaging Het
Vmn1r55 A T 7: 5,150,025 (GRCm39) C133S probably damaging Het
Vmn2r8 T A 5: 108,949,566 (GRCm39) D427V probably benign Het
Vwde A G 6: 13,205,851 (GRCm39) I232T possibly damaging Het
Wnk1 C A 6: 119,940,431 (GRCm39) A769S probably damaging Het
Xpo4 A C 14: 57,855,638 (GRCm39) S264A probably benign Het
Zfp330 A T 8: 83,496,015 (GRCm39) C75* probably null Het
Zfp526 T A 7: 24,925,064 (GRCm39) L441Q probably benign Het
Zfp607b T G 7: 27,402,930 (GRCm39) L462R probably damaging Het
Zfp719 T A 7: 43,240,217 (GRCm39) F602I probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCCAGGTGAAGAAGGTG -3'
(R):5'- CAGAAGTGGAATGTCCTGACTC -3'

Sequencing Primer
(F):5'- TGAAGAAGGTGGGCAGGTCC -3'
(R):5'- GAAGTGGAATGTCCTGACTCTTACC -3'
Posted On 2015-11-11