Incidental Mutation 'R4755:Col4a4'
ID 357866
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Name collagen, type IV, alpha 4
Synonyms E130010M05Rik, [a]4(IV)
MMRRC Submission 042033-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R4755 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 82426144-82564570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82518895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 100 (D100G)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
AlphaFold Q9QZR9
Predicted Effect unknown
Transcript: ENSMUST00000087050
AA Change: D100G
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: D100G

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135271
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,733,280 (GRCm39) noncoding transcript Het
Aadacl2fm1 C T 3: 59,843,735 (GRCm39) A143V probably benign Het
Accs T C 2: 93,671,682 (GRCm39) E236G probably damaging Het
Agrn C T 4: 156,257,979 (GRCm39) probably benign Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Akap5 C A 12: 76,374,581 (GRCm39) C4* probably null Het
Amotl2 A T 9: 102,597,679 (GRCm39) H146L probably damaging Het
Ank1 A G 8: 23,594,990 (GRCm39) N666S probably damaging Het
Atp10d A T 5: 72,403,509 (GRCm39) T373S probably benign Het
Bpifb9b T A 2: 154,161,614 (GRCm39) M582K probably benign Het
Brca2 T A 5: 150,483,452 (GRCm39) probably null Het
Ccdc149 A G 5: 52,561,493 (GRCm39) V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdk5rap2 A G 4: 70,156,662 (GRCm39) S1617P probably damaging Het
Cenpk A T 13: 104,367,379 (GRCm39) M37L probably benign Het
Cenpk A T 13: 104,386,020 (GRCm39) H305L probably benign Het
Ces5a C A 8: 94,262,305 (GRCm39) A11S probably benign Het
Cfap65 T C 1: 74,967,520 (GRCm39) E186G probably damaging Het
Cfh T A 1: 140,016,546 (GRCm39) I593F probably damaging Het
Clstn2 C T 9: 97,327,726 (GRCm39) V961I probably benign Het
Cog5 T A 12: 31,919,405 (GRCm39) probably null Het
Cyp3a41a T C 5: 145,652,316 (GRCm39) D61G probably damaging Het
Dnah10 A G 5: 124,824,809 (GRCm39) N655S probably benign Het
Dnai1 C G 4: 41,610,269 (GRCm39) T295R probably damaging Het
Dnajc6 C T 4: 101,407,996 (GRCm39) A44V probably damaging Het
Eif4enif1 A T 11: 3,194,016 (GRCm39) D960V probably damaging Het
Fam167b C T 4: 129,472,135 (GRCm39) G12R probably damaging Het
Fam20b A T 1: 156,515,066 (GRCm39) Y266* probably null Het
Fer1l6 T A 15: 58,512,060 (GRCm39) V1509D probably benign Het
Fhad1 A T 4: 141,655,794 (GRCm39) I105N probably damaging Het
Fmo2 T C 1: 162,716,374 (GRCm39) D71G probably damaging Het
Folr2 T C 7: 101,493,006 (GRCm39) T6A possibly damaging Het
Fry A C 5: 150,321,719 (GRCm39) E1018A probably damaging Het
Gas2l2 A G 11: 83,320,193 (GRCm39) I21T probably damaging Het
Gfra1 T C 19: 58,441,676 (GRCm39) Y85C probably damaging Het
Gpld1 A T 13: 25,163,671 (GRCm39) Y43F probably benign Het
Gpld1 T A 13: 25,163,675 (GRCm39) Y44* probably null Het
Grid2 A G 6: 63,885,972 (GRCm39) T123A probably benign Het
Grina T C 15: 76,133,442 (GRCm39) L305P probably damaging Het
Gucy1a1 G A 3: 82,002,102 (GRCm39) A659V probably benign Het
H2-T10 T A 17: 36,429,837 (GRCm39) K319* probably null Het
Hey2 A T 10: 30,710,300 (GRCm39) V151E probably benign Het
Ighv1-69 G A 12: 115,587,178 (GRCm39) T13I probably benign Het
Il1rap C A 16: 26,541,532 (GRCm39) A591E probably benign Het
Ildr1 T C 16: 36,542,383 (GRCm39) L261P probably benign Het
Jak1 A G 4: 101,031,354 (GRCm39) Y463H probably damaging Het
Lrp1b T C 2: 41,159,285 (GRCm39) I1666V probably benign Het
Lrp1b T A 2: 41,361,028 (GRCm39) T592S probably benign Het
Lrrc36 A G 8: 106,178,776 (GRCm39) T445A possibly damaging Het
Ly9 G A 1: 171,434,806 (GRCm39) S29F probably damaging Het
Mapk7 A C 11: 61,381,669 (GRCm39) C32W probably damaging Het
Marchf10 C T 11: 105,255,302 (GRCm39) probably benign Het
Mier2 A T 10: 79,385,031 (GRCm39) M119K probably damaging Het
Mpv17 A T 5: 31,303,326 (GRCm39) C59* probably null Het
Mrpl27 G A 11: 94,544,659 (GRCm39) probably benign Het
Myo18b G A 5: 113,022,340 (GRCm39) Q351* probably null Het
Myo1a A G 10: 127,551,557 (GRCm39) I704M probably damaging Het
Nadsyn1 A G 7: 143,360,650 (GRCm39) C373R probably damaging Het
Nckipsd C A 9: 108,691,938 (GRCm39) A513E probably benign Het
Neb T C 2: 52,110,221 (GRCm39) D209G probably damaging Het
Nkapl T A 13: 21,652,457 (GRCm39) Q52L unknown Het
Nptx2 G A 5: 144,483,250 (GRCm39) S126N probably benign Het
Or2a7 G A 6: 43,150,977 (GRCm39) S19N probably benign Het
Or52d3 T A 7: 104,229,268 (GRCm39) Y138* probably null Het
Or7g17 A T 9: 18,768,476 (GRCm39) H185L probably benign Het
Or8b52 A G 9: 38,577,128 (GRCm39) V4A probably benign Het
Pclo A T 5: 14,764,362 (GRCm39) R4278S unknown Het
Pcnx1 T G 12: 81,997,068 (GRCm39) L988R probably damaging Het
Prl2c5 C A 13: 13,363,970 (GRCm39) N75K probably benign Het
Prpf19 T G 19: 10,875,154 (GRCm39) probably benign Het
Ralgapa1 A G 12: 55,759,533 (GRCm39) S997P probably damaging Het
Rangap1 T C 15: 81,597,118 (GRCm39) T226A probably benign Het
Rimklb G A 6: 122,433,365 (GRCm39) L262F probably damaging Het
Rnf169 A G 7: 99,574,930 (GRCm39) M555T probably benign Het
Rp1l1 A T 14: 64,267,519 (GRCm39) D1035V probably benign Het
Rps23rg1 A T 8: 3,633,922 (GRCm39) S8C probably damaging Het
Scd2 T A 19: 44,289,791 (GRCm39) L262Q probably damaging Het
Scgb2b12 T A 7: 32,024,956 (GRCm39) M84L probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 G A 12: 82,419,160 (GRCm39) V613I possibly damaging Het
Slc25a23 T A 17: 57,359,794 (GRCm39) D67V possibly damaging Het
Slc25a39 C T 11: 102,297,492 (GRCm39) probably benign Het
Slc4a10 T A 2: 62,127,332 (GRCm39) F895Y probably damaging Het
Slc5a4a A C 10: 76,022,398 (GRCm39) K578Q probably benign Het
Slc6a13 G A 6: 121,302,008 (GRCm39) G197S probably damaging Het
Smarca2 A T 19: 26,631,883 (GRCm39) E566V possibly damaging Het
Sorbs3 A T 14: 70,421,548 (GRCm39) N594K probably benign Het
Spata22 A T 11: 73,236,582 (GRCm39) D296V probably damaging Het
Sphk2 G A 7: 45,363,058 (GRCm39) A11V possibly damaging Het
Spp1 A T 5: 104,583,081 (GRCm39) probably benign Het
Strn3 T A 12: 51,656,999 (GRCm39) I760L possibly damaging Het
Syk A T 13: 52,796,022 (GRCm39) Y539F probably benign Het
Tdpoz9-ps1 T C 3: 93,846,093 (GRCm39) probably null Het
Thsd7b T A 1: 130,138,001 (GRCm39) Y1560N probably benign Het
Tmod2 C A 9: 75,504,494 (GRCm39) E42* probably null Het
Tom1l1 T C 11: 90,575,942 (GRCm39) E30G probably damaging Het
Trav10 G A 14: 53,743,518 (GRCm39) A40T probably benign Het
Trav14-2 G A 14: 53,878,237 (GRCm39) probably benign Het
Tril T A 6: 53,795,449 (GRCm39) E591V probably damaging Het
Trp53bp1 T A 2: 121,059,087 (GRCm39) R179* probably null Het
Tspoap1 A T 11: 87,662,489 (GRCm39) D562V possibly damaging Het
Usp44 A T 10: 93,682,768 (GRCm39) H406L probably damaging Het
Vangl1 A G 3: 102,065,608 (GRCm39) I509T probably benign Het
Vax2 T G 6: 83,688,379 (GRCm39) L34W probably damaging Het
Vmn1r55 A T 7: 5,150,025 (GRCm39) C133S probably damaging Het
Vmn2r8 T A 5: 108,949,566 (GRCm39) D427V probably benign Het
Vwde A G 6: 13,205,851 (GRCm39) I232T possibly damaging Het
Wnk1 C A 6: 119,940,431 (GRCm39) A769S probably damaging Het
Xpo4 A C 14: 57,855,638 (GRCm39) S264A probably benign Het
Zfp330 A T 8: 83,496,015 (GRCm39) C75* probably null Het
Zfp526 T A 7: 24,925,064 (GRCm39) L441Q probably benign Het
Zfp607b T G 7: 27,402,930 (GRCm39) L462R probably damaging Het
Zfp719 T A 7: 43,240,217 (GRCm39) F602I probably damaging Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82,469,362 (GRCm39) missense unknown
IGL01092:Col4a4 APN 1 82,444,266 (GRCm39) missense unknown
IGL01104:Col4a4 APN 1 82,444,266 (GRCm39) missense unknown
IGL01413:Col4a4 APN 1 82,448,969 (GRCm39) missense unknown
IGL01518:Col4a4 APN 1 82,433,480 (GRCm39) missense unknown
IGL02014:Col4a4 APN 1 82,501,681 (GRCm39) splice site probably benign
IGL02215:Col4a4 APN 1 82,431,530 (GRCm39) missense unknown
IGL02707:Col4a4 APN 1 82,471,237 (GRCm39) missense unknown
IGL02858:Col4a4 APN 1 82,506,204 (GRCm39) missense unknown
IGL02987:Col4a4 APN 1 82,476,646 (GRCm39) splice site probably benign
IGL03384:Col4a4 APN 1 82,462,159 (GRCm39) missense probably benign 0.04
amazement UTSW 1 82,458,207 (GRCm39) nonsense probably null
aoba UTSW 1 82,513,461 (GRCm39) critical splice donor site probably benign
asombro UTSW 1 82,466,730 (GRCm39) critical splice donor site probably null
astonishment UTSW 1 82,433,449 (GRCm39) missense unknown
wonderment UTSW 1 82,430,865 (GRCm39) missense unknown
IGL02980:Col4a4 UTSW 1 82,447,198 (GRCm39) critical splice donor site probably null
R0028:Col4a4 UTSW 1 82,465,231 (GRCm39) critical splice donor site probably null
R0083:Col4a4 UTSW 1 82,484,832 (GRCm39) critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82,470,270 (GRCm39) missense unknown
R0788:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0789:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0790:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0894:Col4a4 UTSW 1 82,507,377 (GRCm39) splice site probably null
R1217:Col4a4 UTSW 1 82,466,730 (GRCm39) critical splice donor site probably null
R1465:Col4a4 UTSW 1 82,475,543 (GRCm39) splice site probably null
R1465:Col4a4 UTSW 1 82,475,543 (GRCm39) splice site probably null
R1474:Col4a4 UTSW 1 82,458,207 (GRCm39) nonsense probably null
R1508:Col4a4 UTSW 1 82,433,557 (GRCm39) missense unknown
R1640:Col4a4 UTSW 1 82,513,491 (GRCm39) missense unknown
R1678:Col4a4 UTSW 1 82,464,380 (GRCm39) missense unknown
R1827:Col4a4 UTSW 1 82,517,709 (GRCm39) missense unknown
R1930:Col4a4 UTSW 1 82,444,321 (GRCm39) splice site probably null
R1931:Col4a4 UTSW 1 82,444,321 (GRCm39) splice site probably null
R2092:Col4a4 UTSW 1 82,476,667 (GRCm39) missense unknown
R2122:Col4a4 UTSW 1 82,434,592 (GRCm39) missense unknown
R2132:Col4a4 UTSW 1 82,475,581 (GRCm39) missense unknown
R2396:Col4a4 UTSW 1 82,484,793 (GRCm39) missense unknown
R2418:Col4a4 UTSW 1 82,510,657 (GRCm39) missense unknown
R2679:Col4a4 UTSW 1 82,507,332 (GRCm39) missense unknown
R3085:Col4a4 UTSW 1 82,507,285 (GRCm39) critical splice donor site probably null
R3437:Col4a4 UTSW 1 82,474,889 (GRCm39) missense unknown
R3697:Col4a4 UTSW 1 82,518,958 (GRCm39) missense unknown
R3730:Col4a4 UTSW 1 82,433,472 (GRCm39) splice site probably null
R3752:Col4a4 UTSW 1 82,458,215 (GRCm39) missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82,448,909 (GRCm39) critical splice donor site probably null
R4087:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4088:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4090:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4213:Col4a4 UTSW 1 82,430,865 (GRCm39) missense unknown
R4422:Col4a4 UTSW 1 82,467,559 (GRCm39) missense unknown
R4596:Col4a4 UTSW 1 82,448,940 (GRCm39) missense unknown
R4757:Col4a4 UTSW 1 82,506,187 (GRCm39) missense unknown
R4793:Col4a4 UTSW 1 82,516,820 (GRCm39) missense unknown
R4812:Col4a4 UTSW 1 82,439,874 (GRCm39) missense unknown
R4833:Col4a4 UTSW 1 82,507,323 (GRCm39) missense unknown
R5259:Col4a4 UTSW 1 82,431,614 (GRCm39) missense unknown
R5264:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5265:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5281:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5283:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5284:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5387:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5388:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5435:Col4a4 UTSW 1 82,431,728 (GRCm39) missense unknown
R5534:Col4a4 UTSW 1 82,465,238 (GRCm39) missense unknown
R5666:Col4a4 UTSW 1 82,463,300 (GRCm39) critical splice donor site probably null
R5670:Col4a4 UTSW 1 82,463,300 (GRCm39) critical splice donor site probably null
R5943:Col4a4 UTSW 1 82,502,737 (GRCm39) missense unknown
R5996:Col4a4 UTSW 1 82,433,449 (GRCm39) missense unknown
R5999:Col4a4 UTSW 1 82,470,340 (GRCm39) missense unknown
R6112:Col4a4 UTSW 1 82,431,604 (GRCm39) missense unknown
R6192:Col4a4 UTSW 1 82,462,151 (GRCm39) missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82,484,752 (GRCm39) missense unknown
R6419:Col4a4 UTSW 1 82,444,207 (GRCm39) critical splice donor site probably null
R6458:Col4a4 UTSW 1 82,433,546 (GRCm39) missense unknown
R6460:Col4a4 UTSW 1 82,444,253 (GRCm39) missense unknown
R6481:Col4a4 UTSW 1 82,431,499 (GRCm39) missense unknown
R6522:Col4a4 UTSW 1 82,465,304 (GRCm39) missense unknown
R7000:Col4a4 UTSW 1 82,475,051 (GRCm39) missense unknown
R7015:Col4a4 UTSW 1 82,484,671 (GRCm39) missense unknown
R7055:Col4a4 UTSW 1 82,496,757 (GRCm39) missense unknown
R7288:Col4a4 UTSW 1 82,470,184 (GRCm39) missense unknown
R7293:Col4a4 UTSW 1 82,501,664 (GRCm39) missense unknown
R7300:Col4a4 UTSW 1 82,464,361 (GRCm39) missense unknown
R7458:Col4a4 UTSW 1 82,476,669 (GRCm39) missense unknown
R7520:Col4a4 UTSW 1 82,484,808 (GRCm39) nonsense probably null
R7727:Col4a4 UTSW 1 82,506,514 (GRCm39) missense unknown
R7803:Col4a4 UTSW 1 82,467,419 (GRCm39) critical splice donor site probably null
R7953:Col4a4 UTSW 1 82,431,689 (GRCm39) missense unknown
R7959:Col4a4 UTSW 1 82,484,780 (GRCm39) missense unknown
R7982:Col4a4 UTSW 1 82,549,162 (GRCm39) start gained probably benign
R8000:Col4a4 UTSW 1 82,519,018 (GRCm39) missense unknown
R8057:Col4a4 UTSW 1 82,501,591 (GRCm39) missense unknown
R8126:Col4a4 UTSW 1 82,431,007 (GRCm39) missense unknown
R8406:Col4a4 UTSW 1 82,501,611 (GRCm39) missense unknown
R8699:Col4a4 UTSW 1 82,433,455 (GRCm39) missense unknown
R8835:Col4a4 UTSW 1 82,447,313 (GRCm39) missense unknown
R8916:Col4a4 UTSW 1 82,501,667 (GRCm39) missense unknown
R8921:Col4a4 UTSW 1 82,431,533 (GRCm39) missense unknown
R8990:Col4a4 UTSW 1 82,473,555 (GRCm39) missense unknown
R9002:Col4a4 UTSW 1 82,449,032 (GRCm39) missense probably benign 0.26
R9116:Col4a4 UTSW 1 82,431,752 (GRCm39) missense unknown
R9176:Col4a4 UTSW 1 82,463,349 (GRCm39) missense unknown
R9211:Col4a4 UTSW 1 82,506,501 (GRCm39) missense unknown
R9246:Col4a4 UTSW 1 82,430,956 (GRCm39) missense unknown
R9463:Col4a4 UTSW 1 82,431,076 (GRCm39) missense unknown
R9666:Col4a4 UTSW 1 82,496,670 (GRCm39) missense unknown
R9686:Col4a4 UTSW 1 82,474,962 (GRCm39) missense unknown
R9705:Col4a4 UTSW 1 82,465,313 (GRCm39) missense unknown
R9749:Col4a4 UTSW 1 82,463,353 (GRCm39) missense unknown
R9774:Col4a4 UTSW 1 82,484,665 (GRCm39) critical splice donor site probably null
X0020:Col4a4 UTSW 1 82,517,673 (GRCm39) critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82,430,917 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CACTGTAGCTGCATAGATTTTCC -3'
(R):5'- CTCTATACTCACAGGGACGTGC -3'

Sequencing Primer
(F):5'- GCTGCATAGATTTTCCCTTCTTTTTC -3'
(R):5'- ACGTGCCTGTGTTAGCAAAC -3'
Posted On 2015-11-11