Incidental Mutation 'R4755:Neb'
ID 357874
Institutional Source Beutler Lab
Gene Symbol Neb
Ensembl Gene ENSMUSG00000026950
Gene Name nebulin
Synonyms
MMRRC Submission 042033-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.818) question?
Stock # R4755 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 52136647-52378474 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52220209 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 209 (D209G)
Ref Sequence ENSEMBL: ENSMUSP00000028320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028320] [ENSMUST00000036934] [ENSMUST00000075301]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028320
AA Change: D209G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028320
Gene: ENSMUSG00000026950
AA Change: D209G

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
NEBU 103 134 9.67e-1 SMART
NEBU 137 167 6.6e-7 SMART
NEBU 172 202 9.7e-5 SMART
NEBU 208 238 3.48e-6 SMART
NEBU 246 276 2.66e-2 SMART
NEBU 281 311 5.32e-2 SMART
NEBU 312 342 2.94e-4 SMART
NEBU 346 377 1.34e1 SMART
NEBU 380 410 2.06e-8 SMART
NEBU 415 445 1.67e-8 SMART
NEBU 450 480 8.57e-6 SMART
NEBU 487 518 8.47e0 SMART
NEBU 523 553 5.2e-5 SMART
NEBU 554 584 1.07e-6 SMART
NEBU 589 619 9.55e-4 SMART
NEBU 622 652 6.21e-3 SMART
NEBU 657 686 4.89e-1 SMART
NEBU 692 722 4.7e-3 SMART
NEBU 730 760 1.16e-2 SMART
NEBU 765 795 5.32e-2 SMART
NEBU 796 826 3.62e-4 SMART
NEBU 831 861 1.88e-2 SMART
NEBU 866 896 1.59e-9 SMART
NEBU 901 931 2.7e-3 SMART
NEBU 937 967 4.93e0 SMART
NEBU 975 1005 2.89e1 SMART
NEBU 1010 1040 1.94e-4 SMART
NEBU 1041 1071 3.2e-5 SMART
NEBU 1076 1106 3.71e-1 SMART
NEBU 1111 1141 1.52e-6 SMART
NEBU 1146 1176 4.56e-1 SMART
NEBU 1182 1212 2.39e-4 SMART
NEBU 1220 1250 1.59e1 SMART
NEBU 1255 1285 4.32e-2 SMART
NEBU 1286 1316 4.39e0 SMART
NEBU 1321 1351 5.04e-3 SMART
NEBU 1356 1386 8.78e-3 SMART
NEBU 1392 1422 6.02e-1 SMART
NEBU 1427 1457 5.24e-1 SMART
NEBU 1463 1493 1.53e-2 SMART
NEBU 1498 1528 1.94e-4 SMART
NEBU 1533 1563 1.16e-2 SMART
NEBU 1568 1598 2.51e1 SMART
NEBU 1603 1633 2.81e-1 SMART
NEBU 1638 1668 7.64e-3 SMART
NEBU 1673 1703 5.62e-1 SMART
NEBU 1708 1738 1.49e-5 SMART
NEBU 1743 1773 3.97e-1 SMART
NEBU 1778 1808 1.47e-4 SMART
NEBU 1813 1843 6.45e-1 SMART
NEBU 1848 1878 1.28e-4 SMART
NEBU 1883 1913 9.33e-7 SMART
NEBU 1918 1948 7.58e-7 SMART
NEBU 1954 1984 1.94e-4 SMART
NEBU 1989 2019 9.93e-2 SMART
NEBU 2024 2054 2.45e-1 SMART
NEBU 2059 2089 8.39e-1 SMART
NEBU 2094 2124 1e-6 SMART
NEBU 2131 2161 7.35e-5 SMART
NEBU 2168 2198 1.37e-4 SMART
NEBU 2202 2232 2.83e-6 SMART
NEBU 2237 2267 1.52e-6 SMART
NEBU 2274 2304 5.21e0 SMART
NEBU 2309 2339 7.53e-2 SMART
NEBU 2344 2374 2.5e-7 SMART
NEBU 2377 2409 1.16e-2 SMART
NEBU 2416 2446 1.47e-4 SMART
NEBU 2453 2483 3.2e-5 SMART
NEBU 2491 2521 8.07e-2 SMART
NEBU 2526 2556 1.92e-8 SMART
NEBU 2561 2591 1.08e-2 SMART
NEBU 2596 2626 7.07e-7 SMART
NEBU 2627 2657 2.39e-4 SMART
NEBU 2658 2688 2.39e-4 SMART
NEBU 2689 2719 5.97e-5 SMART
NEBU 2720 2750 2.08e-4 SMART
NEBU 2751 2781 1.02e-3 SMART
NEBU 2787 2817 2.14e-6 SMART
NEBU 2822 2852 1.66e0 SMART
low complexity region 2902 2916 N/A INTRINSIC
SH3 2988 3044 5.11e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036934
SMART Domains Protein: ENSMUSP00000047763
Gene: ENSMUSG00000026950

DomainStartEndE-ValueType
low complexity region 4 39 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
NEBU 71 102 3.88e-4 SMART
NEBU 108 138 4e-6 SMART
NEBU 143 173 2.3e-6 SMART
NEBU 178 208 2.06e-8 SMART
NEBU 213 243 1.58e-4 SMART
NEBU 248 278 6.01e-10 SMART
NEBU 284 313 1.14e-1 SMART
NEBU 319 349 6.5e-6 SMART
NEBU 358 388 4.39e-3 SMART
NEBU 393 423 6.01e0 SMART
NEBU 429 459 5.12e-4 SMART
NEBU 497 527 5.74e-7 SMART
NEBU 532 562 5.83e-8 SMART
NEBU 568 598 7.69e-8 SMART
NEBU 606 636 2.87e-7 SMART
NEBU 676 706 3.1e-3 SMART
NEBU 744 774 4.59e-6 SMART
NEBU 779 809 9.47e-8 SMART
NEBU 815 845 7.69e-8 SMART
NEBU 853 883 1.17e-7 SMART
NEBU 888 918 4.74e-8 SMART
NEBU 919 949 9.47e-8 SMART
NEBU 954 985 2.05e-3 SMART
NEBU 988 1018 2.11e-5 SMART
NEBU 1023 1053 8.7e-7 SMART
NEBU 1059 1089 8.7e-7 SMART
NEBU 1097 1127 8.25e-8 SMART
NEBU 1132 1162 8e-6 SMART
NEBU 1163 1193 3.79e-7 SMART
NEBU 1199 1229 8.65e-2 SMART
NEBU 1232 1262 1.05e-9 SMART
NEBU 1267 1297 1.92e-8 SMART
NEBU 1303 1333 7.35e-5 SMART
NEBU 1341 1371 9.33e-7 SMART
NEBU 1376 1406 1.18e-3 SMART
NEBU 1407 1437 7.88e-5 SMART
NEBU 1443 1473 1.33e-2 SMART
NEBU 1476 1506 9.47e-8 SMART
NEBU 1511 1541 7.18e-8 SMART
NEBU 1547 1577 7.46e-6 SMART
NEBU 1585 1615 1.07e-6 SMART
NEBU 1620 1650 3.56e-3 SMART
NEBU 1651 1681 9.33e-7 SMART
NEBU 1687 1717 5.36e-7 SMART
NEBU 1720 1750 1.4e-1 SMART
NEBU 1755 1785 3.59e-8 SMART
NEBU 1791 1821 8e-6 SMART
NEBU 1829 1859 1.92e-8 SMART
NEBU 1864 1894 1.61e-1 SMART
NEBU 1895 1925 6.15e-7 SMART
NEBU 1931 1961 2.02e-2 SMART
NEBU 1964 1994 1.77e-7 SMART
NEBU 1999 2029 1.02e-7 SMART
NEBU 2035 2065 3.25e-6 SMART
NEBU 2073 2103 1.18e-8 SMART
NEBU 2108 2138 2.7e-3 SMART
NEBU 2139 2169 4.85e-5 SMART
NEBU 2175 2205 1.22e-1 SMART
NEBU 2208 2238 2.94e-4 SMART
NEBU 2243 2273 1.67e-8 SMART
NEBU 2279 2309 5.12e-4 SMART
NEBU 2317 2347 1.36e-8 SMART
NEBU 2352 2382 4.85e-5 SMART
NEBU 2383 2413 8.57e-6 SMART
NEBU 2418 2448 1.24e-2 SMART
NEBU 2451 2481 2.09e-9 SMART
NEBU 2486 2516 4e-6 SMART
NEBU 2522 2552 6.5e-6 SMART
NEBU 2560 2590 4.06e-7 SMART
NEBU 2595 2625 2.39e-4 SMART
NEBU 2626 2656 3.43e-5 SMART
NEBU 2661 2691 1.48e0 SMART
NEBU 2694 2724 1.84e-5 SMART
NEBU 2729 2759 3.53e-7 SMART
NEBU 2765 2795 3.15e-4 SMART
NEBU 2803 2833 1.23e-6 SMART
NEBU 2838 2868 2.39e-4 SMART
NEBU 2869 2899 5.97e-5 SMART
NEBU 2904 2934 1.33e-2 SMART
NEBU 2937 2967 1.21e-5 SMART
NEBU 2972 3002 8.32e-4 SMART
NEBU 3008 3038 1.04e-4 SMART
NEBU 3046 3076 4.06e-7 SMART
NEBU 3081 3111 3.73e-6 SMART
NEBU 3112 3142 1.28e-4 SMART
NEBU 3147 3177 3.76e-2 SMART
NEBU 3180 3210 3.25e-6 SMART
NEBU 3215 3245 5.97e-5 SMART
NEBU 3251 3281 2.39e-4 SMART
NEBU 3289 3319 3.3e-7 SMART
NEBU 3324 3354 3.94e-5 SMART
NEBU 3355 3385 1.28e-4 SMART
NEBU 3390 3420 3.76e-2 SMART
NEBU 3423 3453 3.25e-6 SMART
NEBU 3458 3488 2.94e-4 SMART
NEBU 3494 3524 1.84e-5 SMART
NEBU 3532 3562 5.2e-5 SMART
NEBU 3567 3597 3.53e-7 SMART
NEBU 3598 3628 1.32e-6 SMART
NEBU 3633 3663 2.32e-2 SMART
NEBU 3666 3696 5.2e-5 SMART
NEBU 3701 3731 1.15e-6 SMART
NEBU 3737 3767 1.81e-4 SMART
NEBU 3775 3805 4.06e-7 SMART
NEBU 3810 3840 3.73e-6 SMART
NEBU 3841 3871 1.97e-5 SMART
NEBU 3876 3906 2.66e-2 SMART
NEBU 3909 3939 8.12e-7 SMART
NEBU 3944 3974 1.1e-8 SMART
NEBU 3980 4010 2.99e-5 SMART
NEBU 4018 4048 1.07e-6 SMART
NEBU 4053 4083 3.94e-5 SMART
NEBU 4084 4114 2.42e-5 SMART
NEBU 4118 4149 2.66e-2 SMART
NEBU 4152 4182 3.64e-9 SMART
NEBU 4187 4217 1.44e-7 SMART
NEBU 4223 4253 2.87e-7 SMART
NEBU 4261 4291 2.83e-6 SMART
NEBU 4296 4326 5.66e-6 SMART
NEBU 4327 4357 6.06e-6 SMART
NEBU 4361 4392 1.34e1 SMART
NEBU 4395 4425 2.06e-8 SMART
NEBU 4430 4460 1.67e-8 SMART
NEBU 4465 4495 8.57e-6 SMART
NEBU 4502 4533 8.47e0 SMART
NEBU 4538 4568 5.2e-5 SMART
NEBU 4569 4599 1.07e-6 SMART
NEBU 4604 4634 9.55e-4 SMART
NEBU 4637 4667 6.21e-3 SMART
NEBU 4672 4701 4.89e-1 SMART
NEBU 4707 4737 4.7e-3 SMART
NEBU 4745 4775 1.16e-2 SMART
NEBU 4780 4810 5.32e-2 SMART
NEBU 4811 4841 3.62e-4 SMART
NEBU 4846 4876 1.88e-2 SMART
NEBU 4881 4911 1.59e-9 SMART
NEBU 4916 4946 2.7e-3 SMART
NEBU 4952 4982 4.93e0 SMART
NEBU 4990 5020 2.89e1 SMART
NEBU 5025 5055 1.94e-4 SMART
NEBU 5056 5086 3.2e-5 SMART
NEBU 5091 5121 3.71e-1 SMART
NEBU 5126 5156 1.52e-6 SMART
NEBU 5161 5191 4.56e-1 SMART
NEBU 5197 5227 2.39e-4 SMART
NEBU 5235 5265 1.59e1 SMART
NEBU 5270 5300 4.32e-2 SMART
NEBU 5301 5331 4.39e0 SMART
NEBU 5336 5366 5.04e-3 SMART
NEBU 5371 5401 8.78e-3 SMART
NEBU 5407 5437 6.02e-1 SMART
NEBU 5442 5472 5.24e-1 SMART
NEBU 5478 5508 1.53e-2 SMART
NEBU 5513 5543 1.94e-4 SMART
NEBU 5548 5578 1.16e-2 SMART
NEBU 5583 5613 2.51e1 SMART
NEBU 5618 5648 2.81e-1 SMART
NEBU 5653 5683 7.64e-3 SMART
NEBU 5688 5718 5.62e-1 SMART
NEBU 5723 5753 1.49e-5 SMART
NEBU 5758 5788 3.97e-1 SMART
NEBU 5793 5823 1.47e-4 SMART
NEBU 5828 5858 6.45e-1 SMART
NEBU 5863 5893 1.28e-4 SMART
NEBU 5898 5928 9.33e-7 SMART
NEBU 5933 5963 7.58e-7 SMART
NEBU 5969 5999 1.94e-4 SMART
NEBU 6004 6034 9.93e-2 SMART
NEBU 6039 6069 2.45e-1 SMART
NEBU 6074 6104 8.39e-1 SMART
NEBU 6109 6139 1e-6 SMART
NEBU 6146 6176 7.35e-5 SMART
NEBU 6183 6213 1.37e-4 SMART
NEBU 6217 6247 2.83e-6 SMART
NEBU 6252 6282 1.52e-6 SMART
NEBU 6289 6319 5.21e0 SMART
NEBU 6324 6354 7.53e-2 SMART
NEBU 6359 6389 2.5e-7 SMART
NEBU 6392 6424 1.16e-2 SMART
NEBU 6431 6461 1.47e-4 SMART
NEBU 6468 6498 3.2e-5 SMART
NEBU 6506 6536 8.07e-2 SMART
NEBU 6541 6571 1.92e-8 SMART
NEBU 6576 6606 1.08e-2 SMART
NEBU 6611 6641 7.07e-7 SMART
NEBU 6642 6672 2.39e-4 SMART
NEBU 6673 6703 2.39e-4 SMART
NEBU 6704 6734 5.97e-5 SMART
NEBU 6735 6765 4.46e-4 SMART
NEBU 6766 6796 2.18e-7 SMART
NEBU 6797 6827 2.64e-6 SMART
NEBU 6828 6858 6.96e-6 SMART
NEBU 6859 6889 6.3e-4 SMART
NEBU 6895 6925 2.14e-6 SMART
NEBU 6930 6960 1.66e0 SMART
low complexity region 7010 7024 N/A INTRINSIC
SH3 7096 7152 5.11e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075301
SMART Domains Protein: ENSMUSP00000074773
Gene: ENSMUSG00000026950

DomainStartEndE-ValueType
low complexity region 4 39 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
NEBU 71 102 3.88e-4 SMART
NEBU 108 138 4e-6 SMART
NEBU 143 173 2.3e-6 SMART
NEBU 178 208 2.06e-8 SMART
NEBU 213 243 1.58e-4 SMART
NEBU 248 278 6.01e-10 SMART
NEBU 284 313 1.14e-1 SMART
NEBU 319 349 6.5e-6 SMART
NEBU 358 388 4.39e-3 SMART
NEBU 393 423 6.01e0 SMART
NEBU 429 459 5.12e-4 SMART
NEBU 497 527 5.74e-7 SMART
NEBU 532 562 5.83e-8 SMART
NEBU 568 598 7.69e-8 SMART
NEBU 606 636 2.87e-7 SMART
NEBU 676 706 3.1e-3 SMART
NEBU 744 774 4.59e-6 SMART
NEBU 779 809 9.47e-8 SMART
NEBU 815 845 7.69e-8 SMART
NEBU 853 883 1.17e-7 SMART
NEBU 888 918 4.74e-8 SMART
NEBU 919 949 9.47e-8 SMART
NEBU 954 985 2.05e-3 SMART
NEBU 988 1018 2.11e-5 SMART
NEBU 1023 1053 8.7e-7 SMART
NEBU 1059 1089 8.7e-7 SMART
NEBU 1097 1127 8.25e-8 SMART
NEBU 1132 1162 8e-6 SMART
NEBU 1163 1193 3.79e-7 SMART
NEBU 1199 1229 8.65e-2 SMART
NEBU 1232 1262 1.05e-9 SMART
NEBU 1267 1297 1.92e-8 SMART
NEBU 1303 1333 7.35e-5 SMART
NEBU 1341 1371 9.33e-7 SMART
NEBU 1376 1406 1.18e-3 SMART
NEBU 1407 1437 7.88e-5 SMART
NEBU 1443 1473 1.33e-2 SMART
NEBU 1476 1506 9.47e-8 SMART
NEBU 1511 1541 7.18e-8 SMART
NEBU 1547 1577 7.46e-6 SMART
NEBU 1585 1615 1.07e-6 SMART
NEBU 1620 1650 3.56e-3 SMART
NEBU 1651 1681 9.33e-7 SMART
NEBU 1687 1717 5.36e-7 SMART
NEBU 1720 1750 1.4e-1 SMART
NEBU 1755 1785 3.59e-8 SMART
NEBU 1791 1821 8e-6 SMART
NEBU 1829 1859 1.92e-8 SMART
NEBU 1864 1894 1.61e-1 SMART
NEBU 1895 1925 6.15e-7 SMART
NEBU 1931 1961 2.02e-2 SMART
NEBU 1964 1994 1.77e-7 SMART
NEBU 1999 2029 1.02e-7 SMART
NEBU 2035 2065 3.25e-6 SMART
NEBU 2073 2103 1.18e-8 SMART
NEBU 2108 2138 2.7e-3 SMART
NEBU 2139 2169 4.85e-5 SMART
NEBU 2175 2205 1.22e-1 SMART
NEBU 2208 2238 2.94e-4 SMART
NEBU 2243 2273 1.67e-8 SMART
NEBU 2279 2309 5.12e-4 SMART
NEBU 2317 2347 1.36e-8 SMART
NEBU 2352 2382 4.85e-5 SMART
NEBU 2383 2413 8.57e-6 SMART
NEBU 2418 2448 1.24e-2 SMART
NEBU 2451 2481 2.09e-9 SMART
NEBU 2486 2516 4e-6 SMART
NEBU 2522 2552 6.5e-6 SMART
NEBU 2560 2590 4.06e-7 SMART
NEBU 2595 2625 2.39e-4 SMART
NEBU 2626 2656 3.43e-5 SMART
NEBU 2661 2691 1.48e0 SMART
NEBU 2694 2724 1.84e-5 SMART
NEBU 2729 2759 3.53e-7 SMART
NEBU 2765 2795 3.15e-4 SMART
NEBU 2803 2833 1.23e-6 SMART
NEBU 2838 2868 2.39e-4 SMART
NEBU 2869 2899 5.97e-5 SMART
NEBU 2904 2934 1.33e-2 SMART
NEBU 2937 2967 1.21e-5 SMART
NEBU 2972 3002 8.32e-4 SMART
NEBU 3008 3038 1.04e-4 SMART
NEBU 3046 3076 4.06e-7 SMART
NEBU 3081 3111 3.73e-6 SMART
NEBU 3112 3142 1.28e-4 SMART
NEBU 3147 3177 3.76e-2 SMART
NEBU 3180 3210 3.25e-6 SMART
NEBU 3215 3245 5.97e-5 SMART
NEBU 3251 3281 2.39e-4 SMART
NEBU 3289 3319 3.3e-7 SMART
NEBU 3324 3354 3.94e-5 SMART
NEBU 3355 3385 1.28e-4 SMART
NEBU 3390 3420 3.76e-2 SMART
NEBU 3423 3453 3.25e-6 SMART
NEBU 3458 3488 2.94e-4 SMART
NEBU 3494 3524 1.84e-5 SMART
NEBU 3532 3562 5.2e-5 SMART
NEBU 3567 3597 3.53e-7 SMART
NEBU 3598 3628 1.32e-6 SMART
NEBU 3633 3663 2.32e-2 SMART
NEBU 3666 3696 5.2e-5 SMART
NEBU 3701 3731 1.15e-6 SMART
NEBU 3737 3767 1.81e-4 SMART
NEBU 3775 3805 4.06e-7 SMART
NEBU 3810 3840 3.73e-6 SMART
NEBU 3841 3871 1.97e-5 SMART
NEBU 3876 3906 2.66e-2 SMART
NEBU 3909 3939 8.12e-7 SMART
NEBU 3944 3974 1.1e-8 SMART
NEBU 3980 4010 2.99e-5 SMART
NEBU 4018 4048 1.07e-6 SMART
NEBU 4053 4083 3.94e-5 SMART
NEBU 4084 4114 2.83e-6 SMART
NEBU 4118 4149 1.34e1 SMART
NEBU 4152 4182 2.06e-8 SMART
NEBU 4187 4217 1.67e-8 SMART
NEBU 4222 4252 8.57e-6 SMART
NEBU 4259 4290 8.47e0 SMART
NEBU 4295 4325 5.2e-5 SMART
NEBU 4326 4356 1.07e-6 SMART
NEBU 4361 4391 9.55e-4 SMART
NEBU 4394 4424 6.21e-3 SMART
NEBU 4429 4458 4.89e-1 SMART
NEBU 4464 4494 4.7e-3 SMART
NEBU 4502 4532 1.16e-2 SMART
NEBU 4537 4567 5.32e-2 SMART
NEBU 4568 4598 3.62e-4 SMART
NEBU 4603 4633 1.88e-2 SMART
NEBU 4638 4668 1.59e-9 SMART
NEBU 4673 4703 2.7e-3 SMART
NEBU 4709 4739 4.93e0 SMART
NEBU 4747 4777 2.89e1 SMART
NEBU 4782 4812 1.94e-4 SMART
NEBU 4813 4843 3.2e-5 SMART
NEBU 4848 4878 3.71e-1 SMART
NEBU 4883 4913 1.52e-6 SMART
NEBU 4918 4948 4.56e-1 SMART
NEBU 4954 4984 2.39e-4 SMART
NEBU 4992 5022 1.59e1 SMART
NEBU 5027 5057 4.32e-2 SMART
NEBU 5058 5088 4.39e0 SMART
NEBU 5093 5123 5.04e-3 SMART
NEBU 5128 5158 8.78e-3 SMART
NEBU 5164 5194 6.02e-1 SMART
NEBU 5199 5229 5.24e-1 SMART
NEBU 5235 5265 1.53e-2 SMART
NEBU 5270 5300 1.94e-4 SMART
NEBU 5305 5335 1.16e-2 SMART
NEBU 5340 5370 2.51e1 SMART
NEBU 5375 5405 2.81e-1 SMART
NEBU 5410 5440 7.64e-3 SMART
NEBU 5445 5475 5.62e-1 SMART
NEBU 5480 5510 1.49e-5 SMART
NEBU 5515 5545 3.97e-1 SMART
NEBU 5550 5580 1.47e-4 SMART
NEBU 5585 5615 6.45e-1 SMART
NEBU 5620 5650 1.28e-4 SMART
NEBU 5655 5685 9.33e-7 SMART
NEBU 5690 5720 7.58e-7 SMART
NEBU 5726 5756 1.94e-4 SMART
NEBU 5761 5791 9.93e-2 SMART
NEBU 5796 5826 2.45e-1 SMART
NEBU 5831 5861 8.39e-1 SMART
NEBU 5866 5896 1e-6 SMART
NEBU 5903 5933 7.35e-5 SMART
NEBU 5940 5970 1.37e-4 SMART
NEBU 5974 6004 2.83e-6 SMART
NEBU 6009 6039 1.52e-6 SMART
NEBU 6046 6076 5.21e0 SMART
NEBU 6081 6111 7.53e-2 SMART
NEBU 6116 6146 2.5e-7 SMART
NEBU 6149 6181 1.16e-2 SMART
NEBU 6188 6218 1.47e-4 SMART
NEBU 6225 6255 3.2e-5 SMART
NEBU 6263 6293 8.07e-2 SMART
NEBU 6298 6328 1.92e-8 SMART
NEBU 6333 6363 1.08e-2 SMART
NEBU 6368 6398 7.07e-7 SMART
NEBU 6399 6429 2.39e-4 SMART
NEBU 6430 6460 2.39e-4 SMART
NEBU 6461 6491 5.97e-5 SMART
NEBU 6492 6522 2.08e-4 SMART
NEBU 6523 6553 2.68e-7 SMART
NEBU 6554 6584 2.64e-6 SMART
NEBU 6585 6615 6.96e-6 SMART
NEBU 6616 6646 6.3e-4 SMART
NEBU 6652 6682 2.14e-6 SMART
NEBU 6687 6717 1.66e0 SMART
low complexity region 6767 6781 N/A INTRINSIC
SH3 6853 6909 5.11e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139672
SMART Domains Protein: ENSMUSP00000121411
Gene: ENSMUSG00000026950

DomainStartEndE-ValueType
NEBU 2 32 1.21e-5 SMART
NEBU 37 67 8.32e-4 SMART
NEBU 73 103 1.04e-4 SMART
NEBU 111 141 4.06e-7 SMART
NEBU 146 176 3.73e-6 SMART
NEBU 177 207 1.28e-4 SMART
NEBU 212 242 3.76e-2 SMART
NEBU 245 275 3.25e-6 SMART
NEBU 280 310 2.94e-4 SMART
NEBU 316 346 1.84e-5 SMART
NEBU 354 384 5.2e-5 SMART
NEBU 389 419 3.53e-7 SMART
NEBU 420 450 1.32e-6 SMART
NEBU 455 485 2.32e-2 SMART
NEBU 488 518 5.2e-5 SMART
NEBU 523 553 1.15e-6 SMART
NEBU 559 589 1.81e-4 SMART
NEBU 597 627 4.06e-7 SMART
NEBU 632 662 3.73e-6 SMART
NEBU 663 693 1.97e-5 SMART
NEBU 698 728 2.66e-2 SMART
NEBU 731 761 8.12e-7 SMART
NEBU 766 796 1.1e-8 SMART
NEBU 802 832 2.99e-5 SMART
NEBU 840 870 1.07e-6 SMART
NEBU 875 905 3.94e-5 SMART
NEBU 906 936 2.42e-5 SMART
NEBU 940 971 2.66e-2 SMART
NEBU 974 1004 3.64e-9 SMART
NEBU 1009 1039 1.44e-7 SMART
NEBU 1045 1075 2.87e-7 SMART
NEBU 1083 1113 2.83e-6 SMART
NEBU 1118 1148 5.66e-6 SMART
NEBU 1149 1179 5.28e-6 SMART
Meta Mutation Damage Score 0.2905 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes nebulin, a giant protein component of the cytoskeletal matrix that coexists with the thick and thin filaments within the sarcomeres of skeletal muscle. In most vertebrates, nebulin accounts for 3 to 4% of the total myofibrillar protein. The encoded protein contains approximately 30-amino acid long modules that can be classified into 7 types and other repeated modules. Protein isoform sizes vary from 600 to 800 kD due to alternative splicing that is tissue-, species-,and developmental stage-specific. Of the 183 exons in the nebulin gene, at least 43 are alternatively spliced, although exons 143 and 144 are not found in the same transcript. Of the several thousand transcript variants predicted for nebulin, the RefSeq Project has decided to create three representative RefSeq records. Mutations in this gene are associated with recessive nemaline myopathy. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to stunted growth, altered sarcomere structure, reduced contractility in skeletal muscle, progressive muscle weakness, and postnatal death. Observed phenotypes may include a stiff gait, blepharoptosis, kyphosis, abnormal suckling, and reduced adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,859 noncoding transcript Het
Accs T C 2: 93,841,337 E236G probably damaging Het
Agrn C T 4: 156,173,522 probably benign Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Akap5 C A 12: 76,327,807 C4* probably null Het
Amotl2 A T 9: 102,720,480 H146L probably damaging Het
Ank1 A G 8: 23,104,974 N666S probably damaging Het
Atp10d A T 5: 72,246,166 T373S probably benign Het
Bpifb9b T A 2: 154,319,694 M582K probably benign Het
Brca2 T A 5: 150,559,987 probably null Het
C130079G13Rik C T 3: 59,936,314 A143V probably benign Het
C330021F23Rik A T 8: 3,583,922 S8C probably damaging Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdk5rap2 A G 4: 70,238,425 S1617P probably damaging Het
Cenpk A T 13: 104,230,871 M37L probably benign Het
Cenpk A T 13: 104,249,512 H305L probably benign Het
Ces5a C A 8: 93,535,677 A11S probably benign Het
Cfap65 T C 1: 74,928,361 E186G probably damaging Het
Cfh T A 1: 140,088,808 I593F probably damaging Het
Clstn2 C T 9: 97,445,673 V961I probably benign Het
Cog5 T A 12: 31,869,406 probably null Het
Col4a4 T C 1: 82,541,174 D100G unknown Het
Cyp3a41a T C 5: 145,715,506 D61G probably damaging Het
Dnah10 A G 5: 124,747,745 N655S probably benign Het
Dnaic1 C G 4: 41,610,269 T295R probably damaging Het
Dnajc6 C T 4: 101,550,799 A44V probably damaging Het
Eif4enif1 A T 11: 3,244,016 D960V probably damaging Het
Fam167b C T 4: 129,578,342 G12R probably damaging Het
Fam20b A T 1: 156,687,496 Y266* probably null Het
Fer1l6 T A 15: 58,640,211 V1509D probably benign Het
Fhad1 A T 4: 141,928,483 I105N probably damaging Het
Fmo2 T C 1: 162,888,805 D71G probably damaging Het
Folr2 T C 7: 101,843,799 T6A possibly damaging Het
Fry A C 5: 150,398,254 E1018A probably damaging Het
Gas2l2 A G 11: 83,429,367 I21T probably damaging Het
Gfra1 T C 19: 58,453,244 Y85C probably damaging Het
Gm9117 T C 3: 93,938,786 probably null Het
Gpld1 T A 13: 24,979,692 Y44* probably null Het
Gpld1 A T 13: 24,979,688 Y43F probably benign Het
Grid2 A G 6: 63,908,988 T123A probably benign Het
Grina T C 15: 76,249,242 L305P probably damaging Het
Gucy1a1 G A 3: 82,094,795 A659V probably benign Het
H2-T10 T A 17: 36,118,945 K319* probably null Het
Hey2 A T 10: 30,834,304 V151E probably benign Het
Ighv1-69 G A 12: 115,623,558 T13I probably benign Het
Il1rap C A 16: 26,722,782 A591E probably benign Het
Ildr1 T C 16: 36,722,021 L261P probably benign Het
Jak1 A G 4: 101,174,157 Y463H probably damaging Het
Lrp1b T C 2: 41,269,273 I1666V probably benign Het
Lrp1b T A 2: 41,471,016 T592S probably benign Het
Lrrc36 A G 8: 105,452,144 T445A possibly damaging Het
Ly9 G A 1: 171,607,238 S29F probably damaging Het
Mapk7 A C 11: 61,490,843 C32W probably damaging Het
March10 C T 11: 105,364,476 probably benign Het
Mier2 A T 10: 79,549,197 M119K probably damaging Het
Mpv17 A T 5: 31,145,982 C59* probably null Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Myo18b G A 5: 112,874,474 Q351* probably null Het
Myo1a A G 10: 127,715,688 I704M probably damaging Het
Nadsyn1 A G 7: 143,806,913 C373R probably damaging Het
Nckipsd C A 9: 108,814,739 A513E probably benign Het
Nkapl T A 13: 21,468,287 Q52L unknown Het
Nptx2 G A 5: 144,546,440 S126N probably benign Het
Olfr13 G A 6: 43,174,043 S19N probably benign Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Olfr829 A T 9: 18,857,180 H185L probably benign Het
Olfr917 A G 9: 38,665,832 V4A probably benign Het
Pclo A T 5: 14,714,348 R4278S unknown Het
Pcnx T G 12: 81,950,294 L988R probably damaging Het
Prl2c5 C A 13: 13,189,385 N75K probably benign Het
Prpf19 T G 19: 10,897,790 probably benign Het
Ralgapa1 A G 12: 55,712,748 S997P probably damaging Het
Rangap1 T C 15: 81,712,917 T226A probably benign Het
Rimklb G A 6: 122,456,406 L262F probably damaging Het
Rnf169 A G 7: 99,925,723 M555T probably benign Het
Rp1l1 A T 14: 64,030,070 D1035V probably benign Het
Scd2 T A 19: 44,301,352 L262Q probably damaging Het
Scgb2b12 T A 7: 32,325,531 M84L probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G A 12: 82,372,386 V613I possibly damaging Het
Slc25a23 T A 17: 57,052,794 D67V possibly damaging Het
Slc25a39 C T 11: 102,406,666 probably benign Het
Slc4a10 T A 2: 62,296,988 F895Y probably damaging Het
Slc5a4a A C 10: 76,186,564 K578Q probably benign Het
Slc6a13 G A 6: 121,325,049 G197S probably damaging Het
Smarca2 A T 19: 26,654,483 E566V possibly damaging Het
Sorbs3 A T 14: 70,184,099 N594K probably benign Het
Spata22 A T 11: 73,345,756 D296V probably damaging Het
Sphk2 G A 7: 45,713,634 A11V possibly damaging Het
Spp1 A T 5: 104,435,215 probably benign Het
Strn3 T A 12: 51,610,216 I760L possibly damaging Het
Syk A T 13: 52,641,986 Y539F probably benign Het
Thsd7b T A 1: 130,210,264 Y1560N probably benign Het
Tmod2 C A 9: 75,597,212 E42* probably null Het
Tom1l1 T C 11: 90,685,116 E30G probably damaging Het
Trav10 G A 14: 53,506,061 A40T probably benign Het
Trav14-2 G A 14: 53,640,780 probably benign Het
Tril T A 6: 53,818,464 E591V probably damaging Het
Trp53bp1 T A 2: 121,228,606 R179* probably null Het
Tspoap1 A T 11: 87,771,663 D562V possibly damaging Het
Usp44 A T 10: 93,846,906 H406L probably damaging Het
Vangl1 A G 3: 102,158,292 I509T probably benign Het
Vax2 T G 6: 83,711,397 L34W probably damaging Het
Vmn1r55 A T 7: 5,147,026 C133S probably damaging Het
Vmn2r8 T A 5: 108,801,700 D427V probably benign Het
Vwde A G 6: 13,205,852 I232T possibly damaging Het
Wnk1 C A 6: 119,963,470 A769S probably damaging Het
Xpo4 A C 14: 57,618,181 S264A probably benign Het
Zfp330 A T 8: 82,769,386 C75* probably null Het
Zfp526 T A 7: 25,225,639 L441Q probably benign Het
Zfp607b T G 7: 27,703,505 L462R probably damaging Het
Zfp719 T A 7: 43,590,793 F602I probably damaging Het
Other mutations in Neb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Neb APN 2 52308747 missense possibly damaging 0.55
IGL00232:Neb APN 2 52235556 missense possibly damaging 0.83
IGL00501:Neb APN 2 52295344 missense probably benign 0.02
IGL00548:Neb APN 2 52243972 missense probably benign 0.33
IGL00556:Neb APN 2 52191949 missense probably benign 0.16
IGL00561:Neb APN 2 52206105 missense probably benign 0.00
IGL00598:Neb APN 2 52208301 missense possibly damaging 0.62
IGL00788:Neb APN 2 52205732 splice site probably benign
IGL00817:Neb APN 2 52243195 missense probably damaging 1.00
IGL00926:Neb APN 2 52270317 splice site probably benign
IGL00975:Neb APN 2 52212728 missense probably benign 0.01
IGL01012:Neb APN 2 52196361 missense probably benign
IGL01014:Neb APN 2 52287158 missense probably benign 0.11
IGL01419:Neb APN 2 52226533 nonsense probably null
IGL01420:Neb APN 2 52157377 missense probably damaging 1.00
IGL01459:Neb APN 2 52176792 missense probably damaging 1.00
IGL01467:Neb APN 2 52159487 missense possibly damaging 0.55
IGL01474:Neb APN 2 52328905 missense unknown
IGL01506:Neb APN 2 52247190 missense probably damaging 1.00
IGL01544:Neb APN 2 52292905 missense possibly damaging 0.62
IGL01608:Neb APN 2 52170536 missense probably damaging 1.00
IGL01681:Neb APN 2 52201486 missense probably damaging 1.00
IGL01717:Neb APN 2 52189867 missense probably damaging 1.00
IGL01743:Neb APN 2 52225667 missense probably damaging 1.00
IGL01774:Neb APN 2 52222970 nonsense probably null
IGL01787:Neb APN 2 52296355 missense possibly damaging 0.56
IGL01822:Neb APN 2 52258746 missense possibly damaging 0.68
IGL01844:Neb APN 2 52170549 missense probably benign 0.01
IGL01871:Neb APN 2 52153069 missense probably damaging 0.99
IGL01878:Neb APN 2 52169840 splice site probably benign
IGL01886:Neb APN 2 52183845 splice site probably benign
IGL01897:Neb APN 2 52280575 missense possibly damaging 0.88
IGL02025:Neb APN 2 52307739 missense probably benign 0.17
IGL02133:Neb APN 2 52212804 splice site probably null
IGL02143:Neb APN 2 52291199 missense probably damaging 0.99
IGL02212:Neb APN 2 52308311 missense probably damaging 1.00
IGL02216:Neb APN 2 52226490 missense probably benign 0.00
IGL02260:Neb APN 2 52205656 missense probably damaging 1.00
IGL02364:Neb APN 2 52296254 nonsense probably null
IGL02424:Neb APN 2 52264191 missense probably damaging 1.00
IGL02449:Neb APN 2 52201906 missense probably benign 0.00
IGL02465:Neb APN 2 52193165 unclassified probably benign
IGL02475:Neb APN 2 52292819 missense probably damaging 1.00
IGL02486:Neb APN 2 52282603 missense possibly damaging 0.86
IGL02527:Neb APN 2 52263947 missense probably damaging 1.00
IGL02527:Neb APN 2 52149213 missense probably benign 0.36
IGL02547:Neb APN 2 52188730 missense probably damaging 1.00
IGL02648:Neb APN 2 52271081 missense possibly damaging 0.79
IGL02685:Neb APN 2 52175301 missense possibly damaging 0.93
IGL02695:Neb APN 2 52255591 missense probably damaging 1.00
IGL02695:Neb APN 2 52211596 splice site probably benign
IGL02731:Neb APN 2 52160703 missense probably damaging 1.00
IGL02738:Neb APN 2 52243850 missense probably damaging 0.99
IGL02750:Neb APN 2 52291055 missense probably benign 0.00
IGL02879:Neb APN 2 52256685 missense possibly damaging 0.95
IGL02887:Neb APN 2 52200721 missense possibly damaging 0.67
IGL02975:Neb APN 2 52298867 missense probably damaging 0.99
IGL03009:Neb APN 2 52179456 splice site probably benign
IGL03036:Neb APN 2 52244153 missense probably damaging 1.00
IGL03076:Neb APN 2 52169088 missense probably damaging 0.99
IGL03091:Neb APN 2 52271312 missense probably benign 0.08
IGL03095:Neb APN 2 52169088 missense probably damaging 0.99
IGL03096:Neb APN 2 52249472 missense possibly damaging 0.59
IGL03107:Neb APN 2 52183825 missense probably benign 0.41
IGL03171:Neb APN 2 52216364 splice site probably benign
IGL03179:Neb APN 2 52176641 missense probably damaging 1.00
IGL03186:Neb APN 2 52169088 missense probably damaging 0.99
IGL03186:Neb APN 2 52210659 splice site probably benign
IGL03187:Neb APN 2 52169088 missense probably damaging 0.99
IGL03209:Neb APN 2 52290819 missense probably damaging 1.00
IGL03214:Neb APN 2 52159548 missense probably damaging 1.00
IGL03214:Neb APN 2 52197844 missense possibly damaging 0.75
IGL03233:Neb APN 2 52308301 missense possibly damaging 0.93
IGL03287:Neb APN 2 52137323 missense probably damaging 1.00
IGL03349:Neb APN 2 52278952 missense possibly damaging 0.88
IGL03369:Neb APN 2 52178037 missense probably benign
IGL03382:Neb APN 2 52325708 missense probably benign 0.00
IGL03410:Neb APN 2 52319705 missense probably benign 0.00
IGL03411:Neb APN 2 52292878 missense probably benign
Crocque UTSW 2 52258176 missense probably damaging 1.00
Fraulein UTSW 2 52298894 missense probably damaging 1.00
mademoiselle UTSW 2 52207725 missense probably damaging 0.99
monsieur UTSW 2 52305283 critical splice donor site probably null
old_folks UTSW 2 52211556 missense probably damaging 0.96
teenage UTSW 2 52271297 critical splice donor site probably null
wedding UTSW 2 52292695 missense possibly damaging 0.89
G1Funyon:Neb UTSW 2 52288835 missense probably benign 0.04
IGL03054:Neb UTSW 2 52271322 missense probably damaging 1.00
PIT4354001:Neb UTSW 2 52245318 missense probably damaging 0.99
PIT4495001:Neb UTSW 2 52212736 missense probably benign 0.00
PIT4581001:Neb UTSW 2 52288802 missense probably damaging 0.98
R0014:Neb UTSW 2 52287156 missense probably damaging 0.99
R0014:Neb UTSW 2 52287156 missense probably damaging 0.99
R0025:Neb UTSW 2 52222774 missense probably damaging 0.99
R0049:Neb UTSW 2 52170467 missense possibly damaging 0.86
R0049:Neb UTSW 2 52170467 missense possibly damaging 0.86
R0052:Neb UTSW 2 52273980 missense possibly damaging 0.62
R0066:Neb UTSW 2 52306530 missense probably damaging 1.00
R0066:Neb UTSW 2 52306530 missense probably damaging 1.00
R0097:Neb UTSW 2 52204894 missense probably damaging 1.00
R0097:Neb UTSW 2 52204894 missense probably damaging 1.00
R0110:Neb UTSW 2 52290743 splice site probably benign
R0147:Neb UTSW 2 52249376 missense probably damaging 0.99
R0148:Neb UTSW 2 52249376 missense probably damaging 0.99
R0173:Neb UTSW 2 52243847 missense probably damaging 1.00
R0201:Neb UTSW 2 52206878 splice site probably benign
R0254:Neb UTSW 2 52243390 missense probably damaging 1.00
R0295:Neb UTSW 2 52284285 missense possibly damaging 0.90
R0314:Neb UTSW 2 52243331 missense probably benign 0.01
R0316:Neb UTSW 2 52195470 missense possibly damaging 0.96
R0380:Neb UTSW 2 52232202 missense probably damaging 1.00
R0389:Neb UTSW 2 52161477 critical splice acceptor site probably null
R0394:Neb UTSW 2 52177559 splice site probably null
R0401:Neb UTSW 2 52188677 splice site probably benign
R0413:Neb UTSW 2 52290739 splice site probably benign
R0427:Neb UTSW 2 52243884 missense possibly damaging 0.83
R0427:Neb UTSW 2 52244069 missense probably damaging 0.98
R0443:Neb UTSW 2 52161477 critical splice acceptor site probably null
R0453:Neb UTSW 2 52313890 splice site probably null
R0468:Neb UTSW 2 52211556 missense probably damaging 0.96
R0510:Neb UTSW 2 52290743 splice site probably benign
R0513:Neb UTSW 2 52308687 missense probably damaging 0.98
R0590:Neb UTSW 2 52137290 missense probably damaging 0.99
R0605:Neb UTSW 2 52264026 missense possibly damaging 0.92
R0608:Neb UTSW 2 52326757 missense probably benign 0.19
R0622:Neb UTSW 2 52212951 missense probably benign 0.09
R0639:Neb UTSW 2 52256124 missense possibly damaging 0.47
R0656:Neb UTSW 2 52225558 splice site probably benign
R0670:Neb UTSW 2 52256124 missense possibly damaging 0.47
R0673:Neb UTSW 2 52256124 missense possibly damaging 0.47
R0732:Neb UTSW 2 52258681 missense probably damaging 1.00
R0732:Neb UTSW 2 52291268 missense probably damaging 1.00
R0736:Neb UTSW 2 52192012 missense probably damaging 1.00
R0764:Neb UTSW 2 52216867 unclassified probably benign
R0811:Neb UTSW 2 52292695 missense possibly damaging 0.89
R0812:Neb UTSW 2 52292695 missense possibly damaging 0.89
R0839:Neb UTSW 2 52277548 missense probably damaging 0.99
R0960:Neb UTSW 2 52212983 missense probably benign 0.17
R1026:Neb UTSW 2 52264110 missense possibly damaging 0.93
R1076:Neb UTSW 2 52204892 missense probably damaging 1.00
R1170:Neb UTSW 2 52196357 missense probably damaging 1.00
R1184:Neb UTSW 2 52263947 missense probably damaging 1.00
R1185:Neb UTSW 2 52296298 missense probably damaging 1.00
R1185:Neb UTSW 2 52296298 missense probably damaging 1.00
R1185:Neb UTSW 2 52296298 missense probably damaging 1.00
R1200:Neb UTSW 2 52167645 missense probably damaging 1.00
R1205:Neb UTSW 2 52222984 missense probably damaging 0.97
R1208:Neb UTSW 2 52303900 nonsense probably null
R1208:Neb UTSW 2 52303900 nonsense probably null
R1229:Neb UTSW 2 52243943 missense probably damaging 1.00
R1240:Neb UTSW 2 52296309 missense possibly damaging 0.92
R1374:Neb UTSW 2 52243389 missense probably damaging 1.00
R1381:Neb UTSW 2 52260532 missense probably damaging 1.00
R1397:Neb UTSW 2 52243943 missense probably damaging 1.00
R1398:Neb UTSW 2 52289646 missense probably damaging 1.00
R1404:Neb UTSW 2 52183275 missense possibly damaging 0.95
R1404:Neb UTSW 2 52183275 missense possibly damaging 0.95
R1452:Neb UTSW 2 52271297 critical splice donor site probably null
R1467:Neb UTSW 2 52230047 missense probably damaging 1.00
R1467:Neb UTSW 2 52230047 missense probably damaging 1.00
R1477:Neb UTSW 2 52264122 missense probably damaging 0.99
R1478:Neb UTSW 2 52175607 missense probably benign 0.29
R1496:Neb UTSW 2 52328734 missense probably damaging 0.99
R1503:Neb UTSW 2 52298620 missense probably damaging 0.96
R1513:Neb UTSW 2 52227244 missense probably damaging 1.00
R1600:Neb UTSW 2 52271604 missense probably damaging 1.00
R1601:Neb UTSW 2 52287252 nonsense probably null
R1638:Neb UTSW 2 52249281 missense probably benign 0.05
R1712:Neb UTSW 2 52243389 missense probably damaging 1.00
R1717:Neb UTSW 2 52308747 missense possibly damaging 0.55
R1720:Neb UTSW 2 52207721 missense probably benign 0.02
R1722:Neb UTSW 2 52256745 missense probably damaging 1.00
R1765:Neb UTSW 2 52204664 missense probably damaging 1.00
R1772:Neb UTSW 2 52235677 missense probably damaging 1.00
R1782:Neb UTSW 2 52284345 nonsense probably null
R1834:Neb UTSW 2 52236895 missense probably damaging 1.00
R1847:Neb UTSW 2 52196295 missense possibly damaging 0.80
R1852:Neb UTSW 2 52228542 missense probably damaging 0.98
R1862:Neb UTSW 2 52162187 splice site probably null
R1864:Neb UTSW 2 52212760 nonsense probably null
R1868:Neb UTSW 2 52326744 missense probably damaging 0.99
R1880:Neb UTSW 2 52258731 missense probably damaging 0.98
R1906:Neb UTSW 2 52308526 missense probably damaging 1.00
R1926:Neb UTSW 2 52279635 missense probably damaging 1.00
R1944:Neb UTSW 2 52228850 missense probably benign 0.23
R1962:Neb UTSW 2 52272937 nonsense probably null
R1970:Neb UTSW 2 52263905 missense possibly damaging 0.77
R1978:Neb UTSW 2 52287345 missense probably damaging 1.00
R1995:Neb UTSW 2 52298732 missense probably damaging 1.00
R2000:Neb UTSW 2 52212970 nonsense probably null
R2006:Neb UTSW 2 52199444 missense probably null 1.00
R2019:Neb UTSW 2 52232276 nonsense probably null
R2034:Neb UTSW 2 52280611 missense possibly damaging 0.78
R2067:Neb UTSW 2 52284263 missense probably benign 0.16
R2104:Neb UTSW 2 52256814 missense probably benign 0.14
R2104:Neb UTSW 2 52271558 missense probably damaging 1.00
R2111:Neb UTSW 2 52284263 missense probably benign 0.16
R2112:Neb UTSW 2 52328764 missense probably damaging 1.00
R2120:Neb UTSW 2 52264064 missense probably damaging 1.00
R2121:Neb UTSW 2 52264064 missense probably damaging 1.00
R2124:Neb UTSW 2 52264064 missense probably damaging 1.00
R2125:Neb UTSW 2 52310638 missense probably damaging 1.00
R2126:Neb UTSW 2 52310638 missense probably damaging 1.00
R2139:Neb UTSW 2 52212588 missense probably damaging 0.99
R2207:Neb UTSW 2 52211567 nonsense probably null
R2228:Neb UTSW 2 52232995 missense probably benign 0.19
R2352:Neb UTSW 2 52287336 missense probably damaging 1.00
R2374:Neb UTSW 2 52263657 missense probably damaging 1.00
R2413:Neb UTSW 2 52210632 missense probably damaging 1.00
R2424:Neb UTSW 2 52209659 splice site probably benign
R2426:Neb UTSW 2 52169053 splice site probably null
R2508:Neb UTSW 2 52195521 missense probably benign 0.23
R2512:Neb UTSW 2 52210831 missense probably damaging 0.99
R2518:Neb UTSW 2 52249511 nonsense probably null
R2899:Neb UTSW 2 52185323 missense probably benign
R3500:Neb UTSW 2 52325785 missense probably damaging 1.00
R3690:Neb UTSW 2 52137385 missense probably damaging 1.00
R3716:Neb UTSW 2 52277470 missense probably damaging 1.00
R3717:Neb UTSW 2 52277470 missense probably damaging 1.00
R3718:Neb UTSW 2 52277470 missense probably damaging 1.00
R3786:Neb UTSW 2 52201915 missense probably damaging 1.00
R3809:Neb UTSW 2 52256789 missense possibly damaging 0.73
R3840:Neb UTSW 2 52207660 critical splice donor site probably null
R3841:Neb UTSW 2 52207660 critical splice donor site probably null
R3956:Neb UTSW 2 52201963 missense possibly damaging 0.62
R3958:Neb UTSW 2 52263629 missense probably damaging 1.00
R4057:Neb UTSW 2 52206699 missense possibly damaging 0.89
R4057:Neb UTSW 2 52237108 missense probably benign 0.32
R4110:Neb UTSW 2 52148766 missense probably benign 0.10
R4110:Neb UTSW 2 52244125 missense probably damaging 1.00
R4128:Neb UTSW 2 52292700 missense probably damaging 1.00
R4195:Neb UTSW 2 52271559 missense probably damaging 1.00
R4195:Neb UTSW 2 52290835 missense probably damaging 1.00
R4288:Neb UTSW 2 52259300 missense probably damaging 1.00
R4323:Neb UTSW 2 52264110 missense possibly damaging 0.93
R4394:Neb UTSW 2 52187513 nonsense probably null
R4463:Neb UTSW 2 52279722 frame shift probably null
R4527:Neb UTSW 2 52193237 missense probably benign 0.42
R4561:Neb UTSW 2 52286155 missense probably damaging 1.00
R4612:Neb UTSW 2 52287243 missense probably damaging 0.99
R4621:Neb UTSW 2 52271039 nonsense probably null
R4628:Neb UTSW 2 52308350 nonsense probably null
R4655:Neb UTSW 2 52227299 missense probably damaging 0.98
R4660:Neb UTSW 2 52255588 missense possibly damaging 0.85
R4683:Neb UTSW 2 52244062 missense possibly damaging 0.89
R4687:Neb UTSW 2 52304035 missense possibly damaging 0.95
R4690:Neb UTSW 2 52244075 missense probably benign 0.25
R4710:Neb UTSW 2 52260598 missense probably benign 0.32
R4729:Neb UTSW 2 52263662 missense possibly damaging 0.80
R4732:Neb UTSW 2 52279079 missense probably damaging 1.00
R4733:Neb UTSW 2 52279079 missense probably damaging 1.00
R4738:Neb UTSW 2 52187482 missense probably damaging 1.00
R4744:Neb UTSW 2 52150577 missense probably benign 0.29
R4756:Neb UTSW 2 52193231 missense probably damaging 0.96
R4763:Neb UTSW 2 52237040 nonsense probably null
R4763:Neb UTSW 2 52326720 nonsense probably null
R4770:Neb UTSW 2 52149153 missense probably benign 0.00
R4801:Neb UTSW 2 52200703 missense possibly damaging 0.65
R4802:Neb UTSW 2 52200703 missense possibly damaging 0.65
R4824:Neb UTSW 2 52204879 missense possibly damaging 0.86
R4830:Neb UTSW 2 52192520 missense probably damaging 0.99
R4855:Neb UTSW 2 52298894 missense probably damaging 1.00
R4857:Neb UTSW 2 52201980 missense probably damaging 1.00
R4878:Neb UTSW 2 52219394 missense probably damaging 1.00
R4885:Neb UTSW 2 52286046 missense probably damaging 1.00
R4888:Neb UTSW 2 52296307 missense probably benign 0.17
R4928:Neb UTSW 2 52212975 missense possibly damaging 0.79
R4954:Neb UTSW 2 52177518 splice site probably null
R4974:Neb UTSW 2 52246859 missense probably damaging 1.00
R4979:Neb UTSW 2 52189909 missense probably damaging 1.00
R4983:Neb UTSW 2 52216261 missense probably damaging 0.99
R4990:Neb UTSW 2 52255546 missense probably benign
R5026:Neb UTSW 2 52204880 missense possibly damaging 0.94
R5030:Neb UTSW 2 52334492 start gained probably benign
R5062:Neb UTSW 2 52280501 missense possibly damaging 0.94
R5063:Neb UTSW 2 52223212 intron probably benign
R5099:Neb UTSW 2 52195448 missense probably damaging 1.00
R5102:Neb UTSW 2 52226570 missense possibly damaging 0.70
R5124:Neb UTSW 2 52281498 missense probably damaging 1.00
R5150:Neb UTSW 2 52169118 missense probably benign 0.09
R5217:Neb UTSW 2 52162130 nonsense probably null
R5280:Neb UTSW 2 52147156 missense probably damaging 1.00
R5288:Neb UTSW 2 52189861 missense probably damaging 0.99
R5314:Neb UTSW 2 52281503 missense probably benign 0.22
R5340:Neb UTSW 2 52223048 missense probably damaging 1.00
R5375:Neb UTSW 2 52212584 missense possibly damaging 0.75
R5385:Neb UTSW 2 52189861 missense probably damaging 0.99
R5411:Neb UTSW 2 52295372 missense probably damaging 0.98
R5470:Neb UTSW 2 52249438 missense possibly damaging 0.88
R5500:Neb UTSW 2 52162067 critical splice donor site probably null
R5523:Neb UTSW 2 52278815 missense probably benign
R5527:Neb UTSW 2 52334453 missense unknown
R5622:Neb UTSW 2 52270269 missense probably damaging 0.96
R5625:Neb UTSW 2 52177535 nonsense probably null
R5688:Neb UTSW 2 52196327 missense probably damaging 1.00
R5715:Neb UTSW 2 52251768 missense probably damaging 1.00
R5716:Neb UTSW 2 52210584 missense probably benign
R5760:Neb UTSW 2 52183818 missense probably damaging 1.00
R5779:Neb UTSW 2 52245301 missense probably damaging 0.99
R5782:Neb UTSW 2 52264047 nonsense probably null
R5862:Neb UTSW 2 52179542 nonsense probably null
R5905:Neb UTSW 2 52193231 missense probably damaging 0.99
R5918:Neb UTSW 2 52197894 missense probably damaging 1.00
R5939:Neb UTSW 2 52257594 missense probably benign
R5959:Neb UTSW 2 52156377 missense probably benign 0.22
R5976:Neb UTSW 2 52216916 missense possibly damaging 0.88
R5987:Neb UTSW 2 52295294 missense probably benign 0.10
R6020:Neb UTSW 2 52257827 missense probably benign 0.05
R6028:Neb UTSW 2 52193231 missense probably damaging 0.99
R6045:Neb UTSW 2 52194425 splice site probably null
R6062:Neb UTSW 2 52185281 missense probably benign 0.05
R6088:Neb UTSW 2 52209342 missense probably damaging 1.00
R6093:Neb UTSW 2 52251770 nonsense probably null
R6119:Neb UTSW 2 52220931 missense probably benign 0.36
R6167:Neb UTSW 2 52147237 missense probably benign 0.12
R6192:Neb UTSW 2 52256790 missense probably benign 0.00
R6216:Neb UTSW 2 52224552 missense probably benign 0.45
R6220:Neb UTSW 2 52270972 missense probably null 0.00
R6239:Neb UTSW 2 52273988 missense probably benign
R6242:Neb UTSW 2 52176812 missense probably damaging 1.00
R6254:Neb UTSW 2 52222961 missense probably benign 0.01
R6262:Neb UTSW 2 52308687 missense probably damaging 0.98
R6305:Neb UTSW 2 52251763 nonsense probably null
R6319:Neb UTSW 2 52163011 critical splice acceptor site probably null
R6333:Neb UTSW 2 52258263 missense probably damaging 1.00
R6341:Neb UTSW 2 52209474 missense probably damaging 1.00
R6362:Neb UTSW 2 52212692 missense probably benign 0.01
R6378:Neb UTSW 2 52293721 missense probably damaging 1.00
R6385:Neb UTSW 2 52185299 missense probably damaging 0.99
R6404:Neb UTSW 2 52207725 missense probably damaging 0.99
R6416:Neb UTSW 2 52185328 missense probably benign 0.10
R6437:Neb UTSW 2 52257557 splice site probably null
R6448:Neb UTSW 2 52148814 missense probably damaging 1.00
R6450:Neb UTSW 2 52194469 nonsense probably null
R6452:Neb UTSW 2 52179483 missense probably benign 0.00
R6455:Neb UTSW 2 52167644 nonsense probably null
R6474:Neb UTSW 2 52280612 missense probably benign 0.00
R6497:Neb UTSW 2 52258289 missense possibly damaging 0.53
R6502:Neb UTSW 2 52291082 missense probably benign 0.34
R6572:Neb UTSW 2 52278847 missense probably damaging 1.00
R6617:Neb UTSW 2 52207747 missense probably damaging 1.00
R6659:Neb UTSW 2 52234353 missense probably damaging 1.00
R6667:Neb UTSW 2 52147189 missense probably damaging 1.00
R6701:Neb UTSW 2 52291208 missense probably damaging 1.00
R6711:Neb UTSW 2 52223064 missense probably benign 0.22
R6711:Neb UTSW 2 52256287 missense probably damaging 1.00
R6861:Neb UTSW 2 52195720 missense probably damaging 1.00
R6872:Neb UTSW 2 52293645 missense probably damaging 0.99
R6886:Neb UTSW 2 52220224 missense probably damaging 1.00
R6923:Neb UTSW 2 52186064 missense probably damaging 0.97
R7025:Neb UTSW 2 52296273 missense possibly damaging 0.94
R7050:Neb UTSW 2 52222876 missense possibly damaging 0.67
R7091:Neb UTSW 2 52256112 missense
R7095:Neb UTSW 2 52177623 missense possibly damaging 0.95
R7102:Neb UTSW 2 52304055 missense probably damaging 1.00
R7114:Neb UTSW 2 52192559 missense probably damaging 1.00
R7152:Neb UTSW 2 52263545 missense probably damaging 1.00
R7156:Neb UTSW 2 52305283 critical splice donor site probably null
R7161:Neb UTSW 2 52271592 missense probably damaging 1.00
R7165:Neb UTSW 2 52270306 missense probably damaging 1.00
R7199:Neb UTSW 2 52220200 missense probably benign 0.01
R7205:Neb UTSW 2 52196356 missense probably damaging 1.00
R7224:Neb UTSW 2 52334659 splice site probably null
R7247:Neb UTSW 2 52258741 missense probably damaging 1.00
R7252:Neb UTSW 2 52324961 critical splice donor site probably null
R7275:Neb UTSW 2 52206944 missense probably benign 0.30
R7284:Neb UTSW 2 52258792 missense probably damaging 0.97
R7316:Neb UTSW 2 52271438 missense possibly damaging 0.80
R7330:Neb UTSW 2 52189703 missense possibly damaging 0.89
R7342:Neb UTSW 2 52281667 missense probably damaging 1.00
R7451:Neb UTSW 2 52201454 missense probably benign
R7464:Neb UTSW 2 52193890 missense probably benign 0.02
R7488:Neb UTSW 2 52220221 missense probably benign
R7498:Neb UTSW 2 52258176 missense probably damaging 1.00
R7513:Neb UTSW 2 52209540 missense possibly damaging 0.83
R7527:Neb UTSW 2 52176623 missense probably damaging 1.00
R7533:Neb UTSW 2 52224566 missense
R7535:Neb UTSW 2 52165103 splice site probably null
R7538:Neb UTSW 2 52256575 splice site probably null
R7547:Neb UTSW 2 52282625 missense probably benign 0.00
R7552:Neb UTSW 2 52247190 missense
R7582:Neb UTSW 2 52334492 start gained probably benign
R7590:Neb UTSW 2 52243842 missense probably damaging 1.00
R7606:Neb UTSW 2 52226444 missense
R7619:Neb UTSW 2 52296426 missense possibly damaging 0.53
R7629:Neb UTSW 2 52273961 missense possibly damaging 0.96
R7660:Neb UTSW 2 52249439 missense
R7663:Neb UTSW 2 52230047 missense
R7678:Neb UTSW 2 52206702 missense probably damaging 1.00
R7693:Neb UTSW 2 52299569 missense probably damaging 0.96
R7728:Neb UTSW 2 52183299 missense probably damaging 1.00
R7750:Neb UTSW 2 52280716 splice site probably null
R7776:Neb UTSW 2 52207701 missense possibly damaging 0.72
R7784:Neb UTSW 2 52235488 missense
R7808:Neb UTSW 2 52192023 missense probably damaging 1.00
R7814:Neb UTSW 2 52137380 missense probably damaging 1.00
R7830:Neb UTSW 2 52165189 missense probably benign 0.04
R7835:Neb UTSW 2 52150577 missense probably benign 0.29
R7836:Neb UTSW 2 52223361 splice site probably null
R7851:Neb UTSW 2 52153064 missense probably benign
R7857:Neb UTSW 2 52222984 missense probably damaging 0.97
R7870:Neb UTSW 2 52325749 missense probably damaging 1.00
R7889:Neb UTSW 2 52147669 missense probably benign 0.00
R7912:Neb UTSW 2 52220985 missense possibly damaging 0.51
R7939:Neb UTSW 2 52186061 missense probably damaging 0.98
R7944:Neb UTSW 2 52271348 missense probably damaging 1.00
R7945:Neb UTSW 2 52271348 missense probably damaging 1.00
R7946:Neb UTSW 2 52212734 missense probably damaging 1.00
R7975:Neb UTSW 2 52160666 missense probably benign 0.01
R8000:Neb UTSW 2 52288844 missense probably damaging 0.99
R8026:Neb UTSW 2 52223048 missense
R8050:Neb UTSW 2 52221726 missense probably benign
R8053:Neb UTSW 2 52286017 missense possibly damaging 0.82
R8114:Neb UTSW 2 52325722 missense possibly damaging 0.88
R8138:Neb UTSW 2 52175695 missense possibly damaging 0.63
R8140:Neb UTSW 2 52209540 missense possibly damaging 0.83
R8152:Neb UTSW 2 52183836 missense probably benign 0.00
R8203:Neb UTSW 2 52149247 nonsense probably null
R8231:Neb UTSW 2 52235479 critical splice donor site probably null
R8293:Neb UTSW 2 52246815 missense probably benign 0.30
R8296:Neb UTSW 2 52226589 missense
R8297:Neb UTSW 2 52308763 missense possibly damaging 0.78
R8301:Neb UTSW 2 52288835 missense probably benign 0.04
R8306:Neb UTSW 2 52209645 missense probably damaging 1.00
R8320:Neb UTSW 2 52296331 missense probably benign 0.00
R8326:Neb UTSW 2 52221702 missense probably damaging 0.99
R8330:Neb UTSW 2 52227408 missense
R8336:Neb UTSW 2 52273890 missense probably damaging 1.00
R8343:Neb UTSW 2 52308271 splice site probably null
R8350:Neb UTSW 2 52206182 missense probably benign 0.31
R8380:Neb UTSW 2 52197811 missense probably benign 0.01
R8395:Neb UTSW 2 52175633 missense probably benign 0.01
R8395:Neb UTSW 2 52257794 missense probably damaging 0.97
R8408:Neb UTSW 2 52157911 missense probably benign 0.32
R8435:Neb UTSW 2 52267717 missense probably benign 0.01
R8442:Neb UTSW 2 52287208 missense probably damaging 0.99
R8450:Neb UTSW 2 52206182 missense probably benign 0.31
R8481:Neb UTSW 2 52224585 missense probably damaging 1.00
R8492:Neb UTSW 2 52313212 missense probably damaging 1.00
R8531:Neb UTSW 2 52291062 missense possibly damaging 0.92
R8550:Neb UTSW 2 52298912 missense probably benign 0.18
R8679:Neb UTSW 2 52325039 missense probably damaging 0.98
R8681:Neb UTSW 2 52237036 missense probably damaging 0.98
R8682:Neb UTSW 2 52246845 missense probably damaging 1.00
R8699:Neb UTSW 2 52147234 missense probably benign
R8699:Neb UTSW 2 52212551 missense probably benign 0.05
R8702:Neb UTSW 2 52195705 missense probably damaging 1.00
R8705:Neb UTSW 2 52258783 missense probably damaging 1.00
R8706:Neb UTSW 2 52291314 missense probably benign
R8717:Neb UTSW 2 52183769 missense probably damaging 0.99
R8746:Neb UTSW 2 52282601 missense probably damaging 1.00
R8749:Neb UTSW 2 52290851 missense probably benign 0.03
R8782:Neb UTSW 2 52188773 missense probably benign 0.00
R8783:Neb UTSW 2 52258632 missense probably damaging 1.00
R8785:Neb UTSW 2 52169890 missense probably damaging 1.00
R8824:Neb UTSW 2 52216911 missense probably damaging 1.00
R8828:Neb UTSW 2 52194426 missense probably damaging 0.99
R8870:Neb UTSW 2 52161469 missense probably damaging 1.00
R8879:Neb UTSW 2 52235580 missense
R8881:Neb UTSW 2 52206987 missense possibly damaging 0.93
R8902:Neb UTSW 2 52243210 missense probably damaging 1.00
R8906:Neb UTSW 2 52206247 missense probably benign 0.05
R8919:Neb UTSW 2 52237129 missense
R8935:Neb UTSW 2 52251768 missense probably damaging 1.00
R8946:Neb UTSW 2 52151413 missense probably damaging 1.00
R9050:Neb UTSW 2 52189889 missense probably damaging 0.99
R9058:Neb UTSW 2 52185329 missense probably benign 0.02
R9114:Neb UTSW 2 52209587 missense probably benign 0.04
R9133:Neb UTSW 2 52193244 missense possibly damaging 0.80
R9137:Neb UTSW 2 52260490 unclassified probably benign
R9149:Neb UTSW 2 52210866 missense possibly damaging 0.84
R9168:Neb UTSW 2 52195684 missense probably damaging 1.00
R9184:Neb UTSW 2 52328755 missense possibly damaging 0.94
R9187:Neb UTSW 2 52206103 missense probably damaging 0.96
R9192:Neb UTSW 2 52313835 missense probably damaging 0.96
R9211:Neb UTSW 2 52245348 missense probably damaging 1.00
R9218:Neb UTSW 2 52293626 critical splice donor site probably null
R9250:Neb UTSW 2 52278901 missense possibly damaging 0.62
R9265:Neb UTSW 2 52199444 missense probably null 1.00
R9275:Neb UTSW 2 52256178 missense probably damaging 1.00
R9278:Neb UTSW 2 52256178 missense probably damaging 1.00
R9288:Neb UTSW 2 52161391 missense probably damaging 1.00
R9310:Neb UTSW 2 52263696 missense probably benign
R9329:Neb UTSW 2 52270219 missense probably benign
R9357:Neb UTSW 2 52179568 critical splice acceptor site probably null
R9366:Neb UTSW 2 52282687 missense probably benign 0.02
R9377:Neb UTSW 2 52149279 critical splice acceptor site probably null
R9377:Neb UTSW 2 52226534 missense
R9378:Neb UTSW 2 52244101 missense possibly damaging 0.53
R9378:Neb UTSW 2 52247292 missense
R9382:Neb UTSW 2 52232265 missense
R9390:Neb UTSW 2 52175145 missense probably benign 0.17
R9404:Neb UTSW 2 52257776 missense probably damaging 1.00
R9416:Neb UTSW 2 52247203 missense
R9424:Neb UTSW 2 52151398 missense probably benign 0.31
R9478:Neb UTSW 2 52188776 missense probably benign 0.09
R9561:Neb UTSW 2 52242056 missense
R9567:Neb UTSW 2 52175126 missense probably damaging 1.00
R9604:Neb UTSW 2 52292668 missense probably benign 0.02
R9641:Neb UTSW 2 52222771 missense
R9673:Neb UTSW 2 52243841 critical splice donor site probably null
R9676:Neb UTSW 2 52170546 missense possibly damaging 0.87
R9709:Neb UTSW 2 52211495 missense probably damaging 0.98
RF001:Neb UTSW 2 52195421 missense probably damaging 1.00
X0021:Neb UTSW 2 52270300 missense probably benign
X0026:Neb UTSW 2 52243904 missense probably benign 0.34
X0027:Neb UTSW 2 52227314 missense probably damaging 1.00
X0065:Neb UTSW 2 52249304 missense possibly damaging 0.95
Z1088:Neb UTSW 2 52169872 missense possibly damaging 0.68
Z1088:Neb UTSW 2 52223152 missense probably benign 0.00
Z1088:Neb UTSW 2 52308567 missense probably damaging 1.00
Z1176:Neb UTSW 2 52267782 missense probably benign 0.26
Z1176:Neb UTSW 2 52279631 critical splice donor site probably null
Z1177:Neb UTSW 2 52162998 missense probably damaging 1.00
Z1177:Neb UTSW 2 52209407 missense possibly damaging 0.89
Z1177:Neb UTSW 2 52256670 missense probably damaging 1.00
Z1177:Neb UTSW 2 52299502 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTTCTTCAAAGCACTGAAC -3'
(R):5'- TCTGCAACCTGTAATGTAGGG -3'

Sequencing Primer
(F):5'- GTTCTTCAAAGCACTGAACAAGTTG -3'
(R):5'- GCAACCTGTAATGTAGGGTTTTATTG -3'
Posted On 2015-11-11